The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer).
More...The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer). The study sites correspond to agricultural fields located within an area of 25 km 2 (6°15’0’ E to 6°21’0’ E and 50°50’5’ N to 50°53’0’ N) of an open-cast lignite mine between Cologne, Aachen, Mönchengladbach, and Düsseldorf. The soil extraction, deposition and recultivation process leads to a chronosequence of fields recultivated from less than one year to fields recultivated for 52 years. During the first three years, fields are permanently covered by alfalfa and never receive artificial fertilisers or biocide treatments (fields recultivated since 2016, 2015, 2014 and 2013, referred to as phase 1). In the following two years, agricultural practises are resumed with barley cropping by RWE Power AG, and a N:P:K (1:0.4:0.6) fertilisation of 437 kg ha−1 a−1 (fields recultivated since 2012 and 2011 referred to as phase 2). Afterwards, fields are returned to farmers and conventionally managed with a crop sequence of winter wheat after sugar beet, one tillage a year to 30 cm depth, and a continuous management practice following area-typical agricultural practice and plant-protection guidelines (fields recultivated since 2006, 1990, 1979, 1971 and 1964, referred to as phase 3). Other agricultural fields that have not yet been subject to extraction were sampled too (referred to as pre-mining phase). The soil fungal community was analyzed with 300 bp paired-end Illumina MiSeq sequencing of ITS2 sequences (primers fITS7: 5′‐GTGARTCATCGAATCTTTG‐3′ / ITS4: 5′‐TCCTCCGCTTATTGATATGC‐3′).
Less...