Format

Send to:

Choose Destination

Links from Nucleotide

NIH_MGC_365

Identifiers
BioSample: SAMN00177748; EST: LIBEST_019141
Organism
Rattus norvegicus (Norway rat)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus
Attributes
tissuewhole brain, pool of 7
lab hostDH10B TonA
tissuebrain/CNS
vectorpExpress-1
v_typeplasmid
re_1EcoRV
re_2NotI
Description

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 2.0kb. This is a non-normalized primary library (normalized primary library is NIH_MGC_366) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection http://mgc.nci.nih.gov/ .

Submission
National Cancer Institute / NIH, Daniela S. Gerhard, Ph.D.; 2006-02-03
Accession:
SAMN00177748
ID:
177748

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center