Format

Send to:

Choose Destination

Links from Nucleotide

Human optic nerve. Unnormalized (nbj)

Identifiers
BioSample: SAMN00150102; EST: LIBEST_019471
Organism
Homo sapiens (human)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Primates; Haplorrhini; Simiiformes; Catarrhini; Hominoidea; Hominidae; Homininae; Homo
Attributes
tissueOptic nerve
development stageadult
lab hostEMDH10B
tissueEye
vectorpCMVSport6
v_typePlasmid
Description

RNA was extracted from pooled human optic nerve. A directionally cloned cDNA library in the pCMVSPORT6 vector (Invitrogen) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System, full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. cDNA was cloned in Not I/Sal I sites. EST analysis was performed at the NIH Intramural Sequencing Center (NISC). Analyzed data available through http://neibank.nei.nih.gov.

Submission
National Eye Institute, Wistow G; 2006-04-10
Accession:
SAMN00150102
ID:
150102

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center