Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Sequence generated in the course of an Arabidopsis T-DNA tagging program. TAIL-PCR was used to generate sequencing templates that represent A.t. genomic DNA flanking the left border of the pDs-Lox T-DNA insert. PCR products were sequenced directly by using the p745 primer 5' AACGTCCGCAATGTGTTATTAAGTTGTC 3'
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on