U.S. flag

An official website of the United States government

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.

McEntyre J, Ostell J, editors. The NCBI Handbook [Internet]. Bethesda (MD): National Center for Biotechnology Information (US); 2002-.

  • This publication is provided for historical reference only and the information may be out of date.

This publication is provided for historical reference only and the information may be out of date.

Cover of The NCBI Handbook

The NCBI Handbook [Internet].

Show details

Table 4Position penalties for SSO nucleotide mismatches

5'10987654321123456789103'
0.220.220.340.340.700.700.800.800.800.800.800.800.800.800.700.700.340.340.220.22
ProbeTTTCTTCACATCCGTGTCCC
DNA templateTTTCTCCACATCCGTGTCCC

Match score calculation for SSO probes.
A 20-mer SSO anneals to a mismatched DNA. Both probe and template are shown in the sense orientation. The substitution of T with C leads to the probe-template mismatch T-G with a penalty of 0.42 (refer to Table 2).
This position has a 70% influence on the overall probe reactivity.
The overall probe score is 1 − (0.7 × 0.42) = 0.71.

Views

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...