GJA5[gene] and "single gene"[properties] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 217

<< First< Prev

Page of 3

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 292436	NM_181703.4(GJA5):c.*1396G>A	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GLikely benign
Select item 292437	NM_181703.4(GJA5):c.*1259C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GUncertain significance
Select item 292438	NM_181703.4(GJA5):c.*1211A>G	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GUncertain significance
Select item 292439	NM_181703.4(GJA5):c.*617TGGTATGTACCTCTGGCAAATGCCC[3]	GJA5	Microsatellite (3 prime UTR variant)	Familial atrial fibrillation	GLikely benign
Select item 292440	NM_181703.4(GJA5):c.*616T>C	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292441	NM_181703.4(GJA5):c.*608C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GLikely benign
Select item 292442	NM_181703.4(GJA5):c.*520A>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292443	NM_181703.4(GJA5):c.*508G>A	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 875073	NM_181703.4(GJA5):c.*498A>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292444	NM_181703.4(GJA5):c.*364C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 875074	NM_181703.4(GJA5):c.*333C>G	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292445	NM_181703.4(GJA5):c.*60C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 1178588	NM_181703.4(GJA5):c.*53=	GJA5	Variation (no sequence alteration)	not provided	GBenign
Select item 292446	NM_181703.4(GJA5):c.*46T>C	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 876005	NM_181703.4(GJA5):c.*22G>A	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 1630920	NM_181703.4(GJA5):c.1071A>T (p.Ser357=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 292447	NM_181703.4(GJA5):c.1068A>G (p.Leu356=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2480712	NM_181703.4(GJA5):c.1066C>A (p.Leu356Ile)	GJA5 (L356I)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2944669	NM_181703.4(GJA5):c.1065C>A (p.Asp355Glu)	GJA5 (D355E)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1583749	NM_181703.4(GJA5):c.1065C>T (p.Asp355=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 876006	NM_181703.4(GJA5):c.1057T>G (p.Ser353Ala)	GJA5 (S353A)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 2932402	NM_181703.4(GJA5):c.1046G>A (p.Ser349Asn)	GJA5 (S349N)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2037104	NM_181703.4(GJA5):c.1039G>C (p.Ala347Pro)	GJA5 (A347P)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 836933	NM_181703.4(GJA5):c.1035_1038del (p.Ser345fs)	GJA5 (S345fs)	Deletion (frameshift variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2951259	NM_181703.4(GJA5):c.1034G>A (p.Ser345Asn)	GJA5 (S345N)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2010788	NM_181703.4(GJA5):c.1030C>A (p.Leu344Ile)	GJA5 (L344I)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1380742	NM_181703.4(GJA5):c.1028G>A (p.Arg343His)	GJA5 (R343H)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1056660	NM_181703.4(GJA5):c.1024C>T (p.Arg342Ter)	GJA5 (R342*)	Single nucleotide variant (nonsense)	not provided +2 more	GUncertain significance
Select item 2156886	NM_181703.4(GJA5):c.1023G>C (p.Lys341Asn)	GJA5 (K341N)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 1627638	NM_181703.4(GJA5):c.1023G>A (p.Lys341=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 2944297	NM_181703.4(GJA5):c.1020C>G (p.Asp340Glu)	GJA5 (D340E)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1391155	NM_181703.4(GJA5):c.1016G>A (p.Ser339Asn)	GJA5 (S339N)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 838990	NM_181703.4(GJA5):c.1006G>A (p.Gly336Ser)	GJA5 (G336S)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 2044403	NM_181703.4(GJA5):c.1000C>A (p.Pro334Thr)	GJA5 (P334T)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 292448	NM_181703.4(GJA5):c.995G>A (p.Arg332His)	GJA5 (R332H)	Single nucleotide variant (missense variant)	Chromosome 1q21.1 deletion syndrome +3 more	GConflicting classifications of pathogenicity
Select item 1444316	NM_181703.4(GJA5):c.994C>T (p.Arg332Cys)	GJA5 (R332C)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2048861	NM_181703.4(GJA5):c.989G>C (p.Gly330Ala)	GJA5 (G330A)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 2934202	NM_181703.4(GJA5):c.978A>C (p.Gly326=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 1316153	NM_181703.4(GJA5):c.977G>C (p.Gly326Ala)	GJA5 (G326A)	Single nucleotide variant (missense variant)	Atrial standstill 1 +2 more	GUncertain significance
Select item 566272	NM_181703.4(GJA5):c.977G>A (p.Gly326Glu)	GJA5 (G326E)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 1465384	NM_181703.4(GJA5):c.974A>G (p.Asn325Ser)	GJA5 (N325S)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 577662	NM_181703.4(GJA5):c.973A>C (p.Asn325His)	GJA5 (N325H)	Single nucleotide variant (missense variant)	Atrial standstill 1 +2 more	GConflicting classifications of pathogenicity
Select item 2939289	NM_181703.4(GJA5):c.963T>G (p.Pro321=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 876987	NM_181703.4(GJA5):c.956A>T (p.Gln319Leu)	GJA5 (Q319L)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 1478969	NM_181703.4(GJA5):c.953G>T (p.Gly318Val)	GJA5 (G318V)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2175267	NM_181703.4(GJA5):c.948T>A (p.Arg316=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 2049301	NM_181703.4(GJA5):c.947G>T (p.Arg316Leu)	GJA5 (R316L)	Single nucleotide variant (missense variant)	Inborn genetic diseases +2 more	GUncertain significance
Select item 1438018	NM_181703.4(GJA5):c.947G>C (p.Arg316Pro)	GJA5 (R316P)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 835840	NM_181703.4(GJA5):c.947G>A (p.Arg316His)	GJA5 (R316H)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 1550636	NM_181703.4(GJA5):c.945T>A (p.Val315=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 2934586	NM_181703.4(GJA5):c.942G>T (p.Gln314His)	GJA5 (Q314H)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1001932	NM_181703.4(GJA5):c.941A>G (p.Gln314Arg)	GJA5 (Q314R)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 876988	NM_181703.4(GJA5):c.938T>C (p.Ile313Thr)	GJA5 (I313T)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 2639123	NM_181703.4(GJA5):c.932G>C (p.Gly311Ala)	GJA5 (G311A)	Single nucleotide variant (missense variant)	Atrial standstill 1 +2 more	GConflicting classifications of pathogenicity
Select item 2927221	NM_181703.4(GJA5):c.926G>C (p.Gly309Ala)	GJA5 (G309A)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 2940977	NM_181703.4(GJA5):c.925G>A (p.Gly309Arg)	GJA5 (G309R)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2927568	NM_181703.4(GJA5):c.923C>G (p.Pro308Arg)	GJA5 (P308R)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1482481	NM_181703.4(GJA5):c.920C>T (p.Thr307Ile)	GJA5 (T307I)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2117646	NM_181703.4(GJA5):c.913G>A (p.Glu305Lys)	GJA5 (E305K)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2050298	NM_181703.4(GJA5):c.908G>A (p.Gly303Asp)	GJA5 (G303D)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1504457	NM_181703.4(GJA5):c.905G>A (p.Arg302Gln)	GJA5 (R302Q)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 666384	NM_181703.4(GJA5):c.904C>T (p.Arg302Ter)	GJA5 (R302*)	Single nucleotide variant (nonsense)	Atrial standstill 1 +1 more	GUncertain significance
Select item 1083545	NM_181703.4(GJA5):c.903A>G (p.Val301=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 487608	NM_181703.4(GJA5):c.895G>A (p.Glu299Lys)	GJA5 (E299K)	Single nucleotide variant (missense variant)	Wolff-Parkinson-White pattern	GUncertain significance
Select item 1345427	NM_181703.4(GJA5):c.893C>G (p.Thr298Ser)	GJA5 (T298S)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 2950202	NM_181703.4(GJA5):c.891C>T (p.Val297=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 1318731	NM_181703.4(GJA5):c.878C>T (p.Thr293Ile)	GJA5 (T293I)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2033763	NM_181703.4(GJA5):c.870A>G (p.Gln290=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 1315925	NM_181703.4(GJA5):c.868C>T (p.Gln290Ter)	GJA5 (Q290*)	Single nucleotide variant (nonsense)	not provided	GUncertain significance
Select item 1621659	NM_181703.4(GJA5):c.867C>T (p.Ser289=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 1107841	NM_181703.4(GJA5):c.864C>T (p.Ala288=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 2139459	NM_181703.4(GJA5):c.863C>T (p.Ala288Val)	GJA5 (A288V)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 1923838	NM_181703.4(GJA5):c.860T>A (p.Met287Lys)	GJA5 (M287K)	Single nucleotide variant (missense variant)	Atrial standstill 1 +2 more	GUncertain significance
Select item 2936140	NM_181703.4(GJA5):c.559A>C (p.Arg187=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 1490722	NM_181703.4(GJA5):c.551T>A (p.Val184Asp)	GJA5 (V184D)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2942467	NM_181703.4(GJA5):c.550G>A (p.Val184Ile)	GJA5 (V184I)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 1081636	NM_181703.4(GJA5):c.544C>T (p.Leu182=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 1607828	NM_181703.4(GJA5):c.543C>T (p.Thr181=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 1463774	NM_181703.4(GJA5):c.542C>T (p.Thr181Ile)	GJA5 (T181I)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1656615	NM_181703.4(GJA5):c.537G>C (p.Leu179=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 2933262	NM_181703.4(GJA5):c.533del (p.Phe178fs)	GJA5 (F178fs)	Deletion (frameshift variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 1365094	NM_181703.4(GJA5):c.526G>A (p.Gly176Arg)	GJA5 (G176R)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2923251	NM_181703.4(GJA5):c.525C>T (p.Tyr175=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 1034934	NM_181703.4(GJA5):c.525C>G (p.Tyr175Ter)	GJA5 (Y175*)	Single nucleotide variant (nonsense)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1981816	NM_181703.4(GJA5):c.521T>A (p.Ile174Asn)	GJA5 (I174N)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 2954301	NM_181703.4(GJA5):c.516C>A (p.Tyr172Ter)	GJA5 (Y172*)	Single nucleotide variant (nonsense)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1581384	NM_181703.4(GJA5):c.516C>T (p.Tyr172=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 758530	NM_181703.4(GJA5):c.513G>A (p.Gln171=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 2093753	NM_181703.4(GJA5):c.510C>A (p.Gly170=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 2927666	NM_181703.4(GJA5):c.497del (p.Gly166fs)	GJA5 (G166fs)	Deletion (frameshift variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 2182825	NM_181703.4(GJA5):c.497G>C (p.Gly166Ala)	GJA5 (G166A)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 577850	NM_181703.4(GJA5):c.496G>A (p.Gly166Ser)	GJA5 (G166S)	Single nucleotide variant (missense variant)	not provided +2 more	GUncertain significance
Select item 1506957	NM_181703.4(GJA5):c.481A>G (p.Thr161Ala)	GJA5 (T161A)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 2117801	NM_181703.4(GJA5):c.479G>A (p.Arg160His)	GJA5 (R160H)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 844690	NM_181703.4(GJA5):c.479G>T (p.Arg160Leu)	GJA5 (R160L)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 970329	NM_181703.4(GJA5):c.478C>T (p.Arg160Cys)	GJA5 (R160C)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 1167134	NM_181703.4(GJA5):c.472C>T (p.Leu158=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GBenign
Select item 2935668	NM_181703.4(GJA5):c.450C>T (p.Leu150=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign
Select item 1592557	NM_181703.4(GJA5):c.447G>C (p.Leu149=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GLikely benign
Select item 2141109	NM_181703.4(GJA5):c.445C>T (p.Leu149=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GLikely benign

<< First< Prev

Page of 3