NM_000314.6(PTEN):c.802-3dupT AND not specified

Clinical significance:Benign (Last evaluated: May 20, 2014)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000180134.1

Allele description [Variation Report for NM_000314.6(PTEN):c.802-3dupT]

NM_000314.6(PTEN):c.802-3dupT

Gene:
PTEN:phosphatase and tensin homolog [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
10q23.31
Genomic location:
Preferred name:
NM_000314.6(PTEN):c.802-3dupT
HGVS:
  • NC_000010.11:g.87960891dup
  • NG_007466.2:g.102453dup
  • NM_000314.7:c.802-3dup
  • NM_001304717.5:c.1322-3dup
  • NM_001304718.2:c.211-3dup
  • LRG_311t1:c.802-3_802-2insT
  • LRG_311t1:c.802-53_802-18delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCinsTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCT
  • LRG_311:g.102453dup
  • NC_000010.10:g.89720633_89720634insT
  • NC_000010.10:g.89720648dup
  • NM_000314.6:c.802-3dupT
Links:
dbSNP: rs34003473
NCBI 1000 Genomes Browser:
rs34003473
Molecular consequence:
  • NM_000314.7:c.802-3dup - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304717.5:c.1322-3dup - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304718.2:c.211-3dup - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Synonyms:
AllHighlyPenetrant
Identifiers:
MedGen: CN169374

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000232521EGL Genetic Diagnostics, Eurofins Clinical Diagnosticscriteria provided, single submitter
Benign
(May 20, 2014)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From EGL Genetic Diagnostics, Eurofins Clinical Diagnostics, SCV000232521.3

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Apr 12, 2021

Support Center