NM_000314.6(PTEN):c.802-3dupT AND PTEN hamartoma tumor syndrome

Clinical significance:Benign (Last evaluated: May 28, 2019)

Review status:2 stars out of maximum of 4 stars

criteria provided, multiple submitters, no conflicts

Based on:
2 submissions [Details]
Record status:
current
Accession:
RCV000198551.4

Allele description [Variation Report for NM_000314.6(PTEN):c.802-3dupT]

NM_000314.6(PTEN):c.802-3dupT

Gene:
PTEN:phosphatase and tensin homolog [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
10q23.31
Genomic location:
Preferred name:
NM_000314.6(PTEN):c.802-3dupT
HGVS:
  • NC_000010.11:g.87960891dup
  • NG_007466.2:g.102453dup
  • NM_000314.7:c.802-3dup
  • NM_001304717.5:c.1322-3dup
  • NM_001304718.2:c.211-3dup
  • LRG_311t1:c.802-3_802-2insT
  • LRG_311t1:c.802-53_802-18delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCinsTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCT
  • LRG_311:g.102453dup
  • NC_000010.10:g.89720633_89720634insT
  • NC_000010.10:g.89720648dup
  • NM_000314.6:c.802-3dupT
Links:
dbSNP: rs34003473
NCBI 1000 Genomes Browser:
rs34003473
Molecular consequence:
  • NM_000314.7:c.802-3dup - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304717.5:c.1322-3dup - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304718.2:c.211-3dup - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Name:
PTEN hamartoma tumor syndrome (PHTS)
Synonyms:
PTEN Hamartomatous Tumour Syndrome
Identifiers:
MONDO: MONDO:0017623; MedGen: C1959582; OMIM: 601728

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000252695Invitaecriteria provided, single submitter
Benign
(Mar 18, 2016)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

SCV001138138Mendelicscriteria provided, single submitter
Benign
(May 28, 2019)
unknownclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing
not providedunknownunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Details of each submission

From Invitae, SCV000252695.4

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From Mendelics, SCV001138138.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1unknownunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Apr 12, 2021

Support Center