ClinVar Genomic variation as it relates to human health
NM_024298.5(MBOAT7):c.680_690dup (p.Leu231fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_024298.5(MBOAT7):c.680_690dup (p.Leu231fs)
Variation ID: 1120120 Accession: VCV001120120.5
- Type and length
-
Duplication, 11 bp
- Location
-
Cytogenetic: 19q13.42 19: 54180936-54180937 (GRCh38) [ NCBI UCSC ] 19: 54684653-54684654 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline May 29, 2021 Dec 17, 2023 Mar 1, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_024298.5:c.680_690dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_077274.3:p.Leu231fs frameshift NM_001146056.3:c.461_471dup NP_001139528.1:p.Leu158fs frameshift NM_001146082.3:c.680_690dup NP_001139554.1:p.Leu231fs frameshift NM_001146083.3:c.461_471dup NP_001139555.1:p.Leu158fs frameshift NC_000019.10:g.54180947_54180957dup NC_000019.9:g.54684664_54684674dup NG_033045.2:g.13929_13939dup - Protein change
- L158fs, L231fs
- Other names
- -
- Canonical SPDI
- NC_000019.10:54180936:GCGGGCGGGCAGCGGGCGGGC:GCGGGCGGGCAGCGGGCGGGCAGCGGGCGGGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MBOAT7 | - | - |
GRCh38 GRCh38 GRCh38 GRCh38 GRCh38 GRCh38 GRCh38 GRCh38 GRCh38 GRCh38 GRCh37 |
99 | 122 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic/Likely pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Mar 1, 2023 | RCV001449806.6 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(Jun 05, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Intellectual disability, autosomal recessive 57
(Autosomal recessive inheritance)
Affected status: unknown
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV001653098.1
First in ClinVar: May 29, 2021 Last updated: May 29, 2021 |
Comment:
The p.Leu231CysfsX8 variant MBOAT7 has not been reported in individuals with disease, but was identified in 1/15420 of European chromosomes by gnomAD (http://gnomad.broadinstitute.org). This variant … (more)
The p.Leu231CysfsX8 variant MBOAT7 has not been reported in individuals with disease, but was identified in 1/15420 of European chromosomes by gnomAD (http://gnomad.broadinstitute.org). This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 231 and leads to a premature termination codon 8 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Loss of function of the MBOAT7 gene is an established disease mechanism in autosomal recessive intellectual disability, epilepsy and autistic features. In summary, although additional studies are required to fully establish its clinical significance, this variant meets criteria to be classified as likely pathogenic for autosomal recessive intellectual disability, epilepsy & autistic features. ACMG/AMP Criteria applied: PM2, PVS1. (less)
Number of individuals with the variant: 1
|
|
Pathogenic
(May 21, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Intellectual disability, autosomal recessive 57
(Autosomal recessive inheritance)
Affected status: unknown
Allele origin:
germline
|
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute
Additional submitter:
Shariant Australia, Australian Genomics
Accession: SCV002769323.1
First in ClinVar: Dec 24, 2022 Last updated: Dec 24, 2022 |
Comment:
A heterozygous duplication variant was identified, NM_024298.4(MBOAT7):c.680_690dup in exon 6 of 8 of the MBOAT7 gene. This duplication is predicted to cause a frameshift from … (more)
A heterozygous duplication variant was identified, NM_024298.4(MBOAT7):c.680_690dup in exon 6 of 8 of the MBOAT7 gene. This duplication is predicted to cause a frameshift from amino acid position 231 introducing a stop codon downstream; NP_077274.3(MBOAT7):p.(Leu231Cysfs*8), resulting in loss of normal protein function through nonsense-mediated decay (NMD). The variant is present in the gnomAD population database at a frequency of 0.003% (1 heterozygote, 0 homozygotes). The variant has not been previously observed in clinical cases, however other variants predicted to cause NMD have been reported as pathogenic in individuals with autosomal recessive MBOAT7 -related intellectual disability (ClinVar). Based on information available at the time of curation, this variant has been classified as PATHOGENIC. (less)
|
|
Likely pathogenic
(Mar 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Intellectual disability, autosomal recessive 57
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
germline
|
Neuberg Centre For Genomic Medicine, NCGM
Accession: SCV004176399.1
First in ClinVar: Dec 17, 2023 Last updated: Dec 17, 2023 |
Comment:
The frameshift c.680_690dup (p.Leu231CysfsTer8) variant in MBOAT7 gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. … (more)
The frameshift c.680_690dup (p.Leu231CysfsTer8) variant in MBOAT7 gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The p.Leu231CysfsTer8 variant is novel (not in any individuals) in gnomAD Exomes and 1000 Genomes. This variant has been reported to the ClinVar database as Pathogenic/ Likely Pathogenic (multiple submissions). This variant causes a frameshift starting with codon Leucine 231, changes this amino acid to Cysteine residue, and creates a premature Stop codon at position 8 of the new reading frame, denoted p.Leu231CysfsTer8. This variant is predicted to cause loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease causing. For these reasons, this variant has been classified as Likely Pathogenic. (less)
Clinical Features:
Abnormality of the nervous system (present)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs1264222654 ...
HelpRecord last updated Apr 06, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.