ClinVar Genomic variation as it relates to human health
NM_000249.4(MLH1):c.1225_1259del (p.Pro408_Gln409insTer)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000249.4(MLH1):c.1225_1259del (p.Pro408_Gln409insTer)
Variation ID: 2418904 Accession: VCV002418904.4
- Type and length
-
Deletion, 35 bp
- Location
-
Cytogenetic: 3p22.2 3: 37025822-37025856 (GRCh38) [ NCBI UCSC ] 3: 37067313-37067347 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 13, 2023 Feb 20, 2024 Apr 4, 2022 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000249.4:c.1225_1259del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000240.1:p.Pro408_Gln409insTer nonsense NM_001167617.3:c.931_965del NP_001161089.1:p.Pro310_Gln311insTer nonsense NM_001167618.3:c.502_536del NP_001161090.1:p.Pro167_Gln168insTer nonsense NM_001167619.3:c.502_536del NP_001161091.1:p.Pro167_Gln168insTer nonsense NM_001258271.2:c.1225_1259del NP_001245200.1:p.Pro408_Gln409insTer nonsense NM_001258273.2:c.502_536del NP_001245202.1:p.Pro167_Gln168insTer nonsense NM_001258274.3:c.502_536del NP_001245203.1:p.Pro167_Gln168insTer nonsense NM_001354615.2:c.502_536del NP_001341544.1:p.Pro167_Gln168insTer nonsense NM_001354616.2:c.502_536del NP_001341545.1:p.Pro167_Gln168insTer nonsense NM_001354617.2:c.502_536del NP_001341546.1:p.Pro167_Gln168insTer nonsense NM_001354618.2:c.502_536del NP_001341547.1:p.Pro167_Gln168insTer nonsense NM_001354619.2:c.502_536del NP_001341548.1:p.Pro167_Gln168insTer nonsense NM_001354620.2:c.931_965del NP_001341549.1:p.Pro310_Gln311insTer nonsense NM_001354621.2:c.202_236del NP_001341550.1:p.Pro67_Gln68insTer nonsense NM_001354622.2:c.202_236del NP_001341551.1:p.Pro67_Gln68insTer nonsense NM_001354623.2:c.202_236del NP_001341552.1:p.Pro67_Gln68insTer nonsense NM_001354624.2:c.151_185del NP_001341553.1:p.Pro50_Gln51insTer nonsense NM_001354625.2:c.151_185del NP_001341554.1:p.Pro50_Gln51insTer nonsense NM_001354626.2:c.151_185del NP_001341555.1:p.Pro50_Gln51insTer nonsense NM_001354627.2:c.151_185del NP_001341556.1:p.Pro50_Gln51insTer nonsense NM_001354628.2:c.1225_1259del NP_001341557.1:p.Pro408_Gln409insTer nonsense NM_001354629.2:c.1126_1160del NP_001341558.1:p.Pro375_Gln376insTer nonsense NM_001354630.2:c.1225_1259del NP_001341559.1:p.Pro408_Gln409insTer nonsense NC_000003.12:g.37025823_37025857del NC_000003.11:g.37067314_37067348del NG_007109.2:g.37474_37508del LRG_216:g.37474_37508del LRG_216t1:c.1225_1259del35 LRG_216p1:p.Gln409Terfs - Protein change
- Other names
- -
- Canonical SPDI
- NC_000003.12:37025821:CCAGGCCATTGTCACAGAGGATAAGACAGATATTTC:C
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MLH1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
5529 | 5584 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Apr 4, 2022 | RCV003112148.4 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Apr 04, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary nonpolyposis colorectal neoplasms
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV003786424.3
First in ClinVar: Feb 13, 2023 Last updated: Feb 20, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. This premature translational stop signal has been observed in individual(s) with Lynch syndrome (PMID: 28874130). … (more)
For these reasons, this variant has been classified as Pathogenic. This premature translational stop signal has been observed in individual(s) with Lynch syndrome (PMID: 28874130). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gln409*) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
A survey of the clinicopathological and molecular characteristics of patients with suspected Lynch syndrome in Latin America. | Rossi BM | BMC cancer | 2017 | PMID: 28874130 |
Application of a 5-tiered scheme for standardized classification of 2,360 unique mismatch repair gene variants in the InSiGHT locus-specific database. | Thompson BA | Nature genetics | 2014 | PMID: 24362816 |
Conversion analysis for mutation detection in MLH1 and MSH2 in patients with colorectal cancer. | Casey G | JAMA | 2005 | PMID: 15713769 |
Text-mined citations for this variant ...
HelpRecord last updated Feb 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.