ClinVar Genomic variation as it relates to human health
NM_000548.5(TSC2):c.3190_3209dup (p.Ser1072_Val1073insLeuSerLeuTerThrSer)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000548.5(TSC2):c.3190_3209dup (p.Ser1072_Val1073insLeuSerLeuTerThrSer)
Variation ID: 2837611 Accession: VCV002837611.1
- Type and length
-
Duplication, 20 bp
- Location
-
Cytogenetic: 16p13.3 16: 2079333-2079334 (GRCh38) [ NCBI UCSC ] 16: 2129334-2129335 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 20, 2024 Feb 20, 2024 Feb 15, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000548.5:c.3190_3209dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000539.2:p.Ser1072_Val1073insLeuSerLeuTerThrSer nonsense inframe insertion NM_001077183.3:c.3058_3077dup NP_001070651.1:p.Ser1028_Val1029insLeuSerLeuTerThrSer nonsense inframe insertion NM_001114382.3:c.3190_3209dup NP_001107854.1:p.Ser1072_Val1073insLeuSerLeuTerThrSer nonsense inframe insertion NM_001318827.2:c.2950_2969dup NP_001305756.1:p.Ser992_Val993insLeuSerLeuTerThrSer nonsense inframe insertion NM_001318829.2:c.2914_2933dup NP_001305758.1:p.Ser980_Val981insLeuSerLeuTerThrSer nonsense inframe insertion NM_001318831.2:c.2458_2477dup NP_001305760.1:p.Ser828_Val829insLeuSerLeuTerThrSer nonsense inframe insertion NM_001318832.2:c.3091_3110dup NP_001305761.1:p.Ser1039_Val1040insLeuSerLeuTerThrSer nonsense inframe insertion NM_001363528.2:c.3061_3080dup NP_001350457.1:p.Ser1029_Val1030insLeuSerLeuTerThrSer nonsense inframe insertion NM_001370404.1:c.3058_3077dup NP_001357333.1:p.Ser1028_Val1029insLeuSerLeuTerThrSer nonsense inframe insertion NM_001370405.1:c.3061_3080dup NP_001357334.1:p.Ser1029_Val1030insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406663.1:c.3187_3206dup NP_001393592.1:p.Ser1071_Val1072insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406664.1:c.3187_3206dup NP_001393593.1:p.Ser1071_Val1072insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406665.1:c.3058_3077dup NP_001393594.1:p.Ser1028_Val1029insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406667.1:c.3151_3170dup NP_001393596.1:p.Ser1059_Val1060insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406668.1:c.3148_3167dup NP_001393597.1:p.Ser1058_Val1059insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406670.1:c.3079_3098dup NP_001393599.1:p.Ser1035_Val1036insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406671.1:c.3049_3068dup NP_001393600.1:p.Ser1025_Val1026insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406673.1:c.3046_3065dup NP_001393602.1:p.Ser1024_Val1025insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406675.1:c.3043_3062dup NP_001393604.1:p.Ser1023_Val1024insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406676.1:c.3040_3059dup NP_001393605.1:p.Ser1022_Val1023insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406677.1:c.3001_3020dup NP_001393606.1:p.Ser1009_Val1010insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406678.1:c.2947_2966dup NP_001393607.1:p.Ser991_Val992insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406679.1:c.2911_2930dup NP_001393608.1:p.Ser979_Val980insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406680.1:c.2590_2609dup NP_001393609.1:p.Ser872_Val873insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406681.1:c.2599_2618dup NP_001393610.1:p.Ser875_Val876insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406682.1:c.2590_2609dup NP_001393611.1:p.Ser872_Val873insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406683.1:c.2590_2609dup NP_001393612.1:p.Ser872_Val873insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406684.1:c.2587_2606dup NP_001393613.1:p.Ser871_Val872insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406685.1:c.2461_2480dup NP_001393614.1:p.Ser829_Val830insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406686.1:c.2461_2480dup NP_001393615.1:p.Ser829_Val830insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406687.1:c.2458_2477dup NP_001393616.1:p.Ser828_Val829insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406688.1:c.2458_2477dup NP_001393617.1:p.Ser828_Val829insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406689.1:c.1846_1865dup NP_001393618.1:p.Ser624_Val625insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406690.1:c.1717_1736dup NP_001393619.1:p.Ser581_Val582insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406691.1:c.1714_1733dup NP_001393620.1:p.Ser580_Val581insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406692.1:c.1717_1736dup NP_001393621.1:p.Ser581_Val582insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406693.1:c.1717_1736dup NP_001393622.1:p.Ser581_Val582insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406694.1:c.1717_1736dup NP_001393623.1:p.Ser581_Val582insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406695.1:c.1714_1733dup NP_001393624.1:p.Ser580_Val581insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406696.1:c.1714_1733dup NP_001393625.1:p.Ser580_Val581insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406697.1:c.1714_1733dup NP_001393626.1:p.Ser580_Val581insLeuSerLeuTerThrSer nonsense inframe insertion NM_001406698.1:c.1456_1475dup NP_001393627.1:p.Ser494_Val495insLeuSerLeuTerThrSer nonsense inframe insertion NM_021055.3:c.3061_3080dup NP_066399.2:p.Ser1029_Val1030insLeuSerLeuTerThrSer nonsense inframe insertion NR_176225.1:n.3211_3230dup non-coding transcript variant NR_176226.1:n.3390_3409dup non-coding transcript variant NR_176227.1:n.3387_3406dup non-coding transcript variant NR_176228.1:n.3208_3227dup non-coding transcript variant NR_176229.1:n.3168_3187dup non-coding transcript variant NC_000016.10:g.2079334_2079353dup NC_000016.9:g.2129335_2129354dup NG_005895.1:g.35029_35048dup LRG_487:g.35029_35048dup LRG_487t1:c.3190_3209dup LRG_487p1:p.Val1073Leufs - Protein change
- Other names
- -
- Canonical SPDI
- NC_000016.10:2079333:AACAAGCTTGTCACTGTGAC:AACAAGCTTGTCACTGTGACAACAAGCTTGTCACTGTGAC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
TSC2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
10625 | 10800 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Feb 15, 2023 | RCV003628320.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Feb 15, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Tuberous sclerosis 2
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV004432417.1
First in ClinVar: Feb 20, 2024 Last updated: Feb 20, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Val1073Leufs*4) in the TSC2 gene. It is expected to result in an absent or disrupted protein … (more)
This sequence change creates a premature translational stop signal (p.Val1073Leufs*4) in the TSC2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in TSC2 are known to be pathogenic (PMID: 10205261, 17304050). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. For these reasons, this variant has been classified as Pathogenic. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Genotype/phenotype correlation in 325 individuals referred for a diagnosis of tuberous sclerosis complex in the United States. | Au KS | Genetics in medicine : official journal of the American College of Medical Genetics | 2007 | PMID: 17304050 |
Comprehensive mutation analysis of TSC1 and TSC2-and phenotypic correlations in 150 families with tuberous sclerosis. | Jones AC | American journal of human genetics | 1999 | PMID: 10205261 |
Text-mined citations for this variant ...
HelpRecord last updated Feb 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.