Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001394783.1(CCR5):c.554_585del (p.Ser185fs)

Help
Interpretation:
Benign​

Review status:
criteria provided, single submitter
Submissions:
5
First in ClinVar:
Apr 4, 2013
Most recent Submission:
Sep 8, 2020
Last evaluated:
Nov 22, 2019
Accession:
VCV000008184.4
Variation ID:
8184
Description:
32bp deletion
Help

NM_001394783.1(CCR5):c.554_585del (p.Ser185fs)

Allele ID
23223
Variant type
Deletion
Variant length
32 bp
Cytogenetic location
3p21.31
Genomic location
3: 46373453-46373484 (GRCh38) GRCh38 UCSC
3: 46414944-46414975 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NM_001394783.1:c.554_585del MANE Select NP_001381712.1:p.Ser185fs frameshift
NM_000579.3:c.554_585delGTCAGTATCAATTCTGGAAGAATTTCCAGACA
NM_000579.4:c.554_585del NP_000570.1:p.Ser185fs frameshift
... more HGVS
Protein change
S185fs
Other names
-
Canonical SPDI
NC_000003.12:46373452:ACAGTCAGTATCAATTCTGGAAGAATTTCCAGACA:ACA
Functional consequence
-
Global minor allele frequency (GMAF)
0.02915 (ACA)

Allele frequency
-
Links
ClinGen: CA119355
OMIM: 601373.0001
dbSNP: rs333
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Benign 1 criteria provided, single submitter Nov 22, 2019 RCV000950102.2
protective 1 no assertion criteria provided Dec 1, 2008 RCV000008663.5
protective 1 no assertion criteria provided Dec 1, 2008 RCV000008665.6
risk factor 1 no assertion criteria provided Dec 1, 2008 RCV000008664.4
risk factor 1 no assertion criteria provided Dec 1, 2008 RCV000008666.5
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
CCR5 - - GRCh38
GRCh37
- 17
CCR5AS - - - GRCh38 - 11

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter More information
Benign
(Nov 22, 2019)
criteria provided, single submitter
Method: clinical testing
not provided
Affected status: unknown
Allele origin: germline
Invitae
Accession: SCV001096383.2
First in ClinVar: Dec 17, 2019
Last updated: May 04, 2020
risk factor
(Dec 01, 2008)
no assertion criteria provided
Method: literature only
WEST NILE VIRUS, SUSCEPTIBILITY TO
Affected status: not provided
Allele origin: germline
OMIM
Accession: SCV000028873.3
First in ClinVar: Apr 04, 2013
Last updated: Sep 08, 2020
Publications:
PubMed (28)
Comment on evidence:
In an HIV-1-exposed patient with slow disease progression (see 609423), Samson et al. (1996) identified a homozygous 32-bp deletion in the CMKBR5 gene that results … (more)
protective
(Dec 01, 2008)
no assertion criteria provided
Method: literature only
HEPATITIS C VIRUS, RESISTANCE TO
Affected status: not provided
Allele origin: germline
OMIM
Accession: SCV000028874.3
First in ClinVar: Apr 04, 2013
Last updated: Sep 08, 2020
Publications:
PubMed (28)
Comment on evidence:
In an HIV-1-exposed patient with slow disease progression (see 609423), Samson et al. (1996) identified a homozygous 32-bp deletion in the CMKBR5 gene that results … (more)
risk factor
(Dec 01, 2008)
no assertion criteria provided
Method: literature only
MULTIPLE SCLEROSIS, DISEASE PROGRESSION, MODIFIER OF
Affected status: not provided
Allele origin: germline
OMIM
Accession: SCV000028875.3
First in ClinVar: Apr 04, 2013
Last updated: Sep 08, 2020
Publications:
PubMed (28)
Comment on evidence:
In an HIV-1-exposed patient with slow disease progression (see 609423), Samson et al. (1996) identified a homozygous 32-bp deletion in the CMKBR5 gene that results … (more)
protective
(Dec 01, 2008)
no assertion criteria provided
Method: literature only
HUMAN IMMUNODEFICIENCY VIRUS TYPE 1, RESISTANCE TO
Affected status: not provided
Allele origin: germline
OMIM
Accession: SCV000028872.3
First in ClinVar: Apr 04, 2013
Last updated: Sep 08, 2020
Publications:
PubMed (28)
Comment on evidence:
In an HIV-1-exposed patient with slow disease progression (see 609423), Samson et al. (1996) identified a homozygous 32-bp deletion in the CMKBR5 gene that results … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Shared and distinct genetic variants in type 1 diabetes and celiac disease. Smyth DJ The New England journal of medicine 2008 PMID: 19073967
Interaction between RANTES promoter variant and CCR5Delta32 favors recovery from hepatitis B. Thio CL Journal of immunology (Baltimore, Md. : 1950) 2008 PMID: 19017985
CCR5 deficiency increases risk of symptomatic West Nile virus infection. Glass WG The Journal of experimental medicine 2006 PMID: 16418398
The case for selection at CCR5-Delta32. Sabeti PC PLoS biology 2005 PMID: 16248677
The geographic spread of the CCR5 Delta32 HIV-resistance allele. Novembre J PLoS biology 2005 PMID: 16216086
The CCR5-delta32 mutation: impact on disease outcome in individuals with hepatitis C infection from a single source. Goulding C Gut 2005 PMID: 15863470
Reappraisal of the historical selective pressures for the CCR5-Delta32 mutation. Duncan SR Journal of medical genetics 2005 PMID: 15744032
A mutated CCR5 gene may have favorable prognostic implications in MS. Kantor R Neurology 2003 PMID: 12874407
Absence of the HIV-1 protective Delta ccr5 allele in most ethnic populations of India. Majumder PP European journal of human genetics : EJHG 2001 PMID: 11781692
The coreceptor mutation CCR5Delta32 influences the dynamics of HIV epidemics and is selected for by HIV. Sullivan AD Proceedings of the National Academy of Sciences of the United States of America 2001 PMID: 11517319
CC chemokine receptor 5 and renal-transplant survival. Fischereder M Lancet (London, England) 2001 PMID: 11403814
Chemokine receptor polymorphism in transplantation immunology: no longer just important in AIDS. Strieter RM Lancet (London, England) 2001 PMID: 11403804
Delta 32 deletion of CCR5 gene and association with asthma or atopy. Mitchell TJ Lancet (London, England) 2000 PMID: 11081537
CC-chemokine receptor 5 polymorphism and age of onset in familial multiple sclerosis. Multiple Sclerosis Genetics Group. Barcellos LF Immunogenetics 2000 PMID: 10803840
Prevalence of CCR5delta32 in allergic diseases. Szalai C Lancet (London, England) 2000 PMID: 10615909
Association of CCR5 delta32 with reduced risk of asthma. Hall IP Lancet (London, England) 1999 PMID: 10520641
Distribution of the CCR5 gene 32-bp deletion in Europe. Lucotte G Journal of acquired immune deficiency syndromes and human retrovirology : official publication of the International Retrovirology Association 1998 PMID: 9768627
Mutational analysis of the CCR5 and CXCR4 genes (HIV-1 co-receptors) in resistance to HIV-1 infection and AIDS development among intravenous drug users. Alvarez V Human genetics 1998 PMID: 9600249
Dating the origin of the CCR5-Delta32 AIDS-resistance allele by the coalescence of haplotypes. Stephens JC American journal of human genetics 1998 PMID: 9585595
First report of a healthy Indian heterozygous for delta 32 mutant of HIV-1 co-receptor-CCR5 gene. Husain S Gene 1998 PMID: 9511755
The deltaccr5 mutation conferring protection against HIV-1 in Caucasian populations has a single and recent origin in Northeastern Europe. Libert F Human molecular genetics 1998 PMID: 9466996
The extent of genetic variation in the CCR5 gene. Ansari-Lari MA Nature genetics 1997 PMID: 9207783
Global distribution of the CCR5 gene 32-basepair deletion. Martinson JJ Nature genetics 1997 PMID: 9140404
Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk. Zimmerman PA Molecular medicine (Cambridge, Mass.) 1997 PMID: 9132277
HIV-1 infection in an individual homozygous for the CCR5 deletion allele. Biti R Nature medicine 1997 PMID: 9055842
Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Liu R Cell 1996 PMID: 8756719
Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Samson M Nature 1996 PMID: 8751444
Molecular cloning and functional expression of a new human CC-chemokine receptor gene. Samson M Biochemistry 1996 PMID: 8639485

Text-mined citations for rs333...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Apr 24, 2022