ClinVar for MedGen (Select 334410) - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from MedGen

Items: 12

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 1705574	NM_000421.5(KRT10):c.470T>G (p.Leu157Arg)	KRT10, KRT10-AS1 (L157R)	Single nucleotide variant (missense variant)	Annular epidermolytic ichthyosis	GLikely pathogenic
Select item 1300082	NM_000421.5(KRT10):c.1459C>T (p.His487Tyr)	KRT10 (H487Y)	Single nucleotide variant (missense variant)	Bullous ichthyosiform erythroderma +3 more	GBenign
Select item 1186831	NM_000421.5(KRT10):c.49GGA[9] (p.Gly24dup)	KRT10, KRT10-AS1	Microsatellite (inframe_insertion)	KRT10-related disorder +4 more	GLikely benign
Select item 1049274	NM_000421.5(KRT10):c.1654AGCTCCGGCGGCGGATACGGCGGCGGCAGC[3] (p.556GYGGGSSSGG[3])	KRT10	Microsatellite (inframe_insertion)	Congenital reticular ichthyosiform erythroderma +3 more	GUncertain significance
Select item 997963	NM_006121.4(KRT1):c.564C>G (p.Asn188Lys)	KRT1 (N188K)	Single nucleotide variant (missense variant)	Annular epidermolytic ichthyosis	GLikely pathogenic
Select item 989261	NM_006121.4(KRT1):c.532T>C (p.Ser178Pro)	KRT1 (S178P)	Single nucleotide variant (missense variant)	Annular epidermolytic ichthyosis	GLikely pathogenic
Select item 516735	NM_000421.5(KRT10):c.1654_1683dup (p.Gly556_Gly565dup)	KRT10	Duplication (inframe_insertion)	KRT10-related disorder +5 more	GBenign/Likely benign
Select item 432078	NM_006121.4(KRT1):c.1453C>T (p.Leu485Phe)	KRT1 (L485F)	Single nucleotide variant (missense variant)	Bullous ichthyosiform erythroderma +6 more	GPathogenic/Likely pathogenic
Select item 66171	NM_000421.5(KRT10):c.376G>A (p.Gly126Ser)	KRT10, KRT10-AS1 (G126S)	Single nucleotide variant (missense variant)	not provided +3 more	GBenign/Likely benign
Select item 15911	NM_006121.4(KRT1):c.1436T>C (p.Ile479Thr)	KRT1 (I479T)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 14580	NM_000421.5(KRT10):c.1264_1265delinsGA (p.Arg422Glu)	KRT10, KRT10-AS1 (R422E)	Indel (missense variant)	Annular epidermolytic ichthyosis	GPathogenic
Select item 14576	NM_000421.5(KRT10):c.466C>T (p.Arg156Cys)	KRT10, KRT10-AS1 (R156C)	Single nucleotide variant (missense variant)	KRT10-related disorder +5 more	GPathogenic