GEO DataSets

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:

Homo sapiens; Mus musculus

Type:

Expression profiling by array; Genome binding/occupancy profiling by high throughput sequencing

6 related Platforms

56 Samples

Download data: BED

(Submitter supplied) Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Platform:

GPL6947

9 Samples

Download data: TXT

(Submitter supplied) The HumanHT-12 V3.0 Expression BeadChip features up-to-date content derived from the National Center for Biotechnology Information Reference Sequence (NCBI RefSeq) database (Build 36.2, Release 22). Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. more...

Organism:

Homo sapiens

13 DataSets

542 Series

1 Related Platform

26115 Samples

Download data: BGX