Similar studies for GEO DataSets (Select 200046360) - GEO DataSets

Select item 2000463601.

Response to catration in PTEN null and PTEN null ERG expressing mouse prostates

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration.

Organism:: Mus musculus

Type:: Expression profiling by array

Platform:: GPL6885
8 Samples

Download data: TXT

Series

Accession:: GSE46360

ID:: 200046360

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 2000472202.

ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:: Homo sapiens; Mus musculus

Type:: Expression profiling by array; Genome binding/occupancy profiling by high throughput sequencing

6 related Platforms
56 Samples

Download data: BED

Series

Accession:: GSE47220

ID:: 200047220

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 2000471203.

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL10999
5 Samples

Download data: BED

Series

Accession:: GSE47120

ID:: 200047120

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 2000471194.

Genomic mapping of ERG, AR, histone H3 monomethyl-K4, histone H3 trimethyl-K4 binding sites in mouse prostates in WT, ERG overexpression, Pten loss mouse prostates

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. We generated a mouse model of ERG ovexpression (Rosa26-ERG) which when crossed into prostate specific probasin-Cre, expressed ERG specifically in the prostate. We crossed Rosa26-ERG into Pten flox/flox allele to generate compound GEMM mouse. Here, we determined the genomic binding sites of ERG, AR, and the histone marks H3K4me1 and H3K4me3 that maps enhancers and promoters respectively in the prostates of these mice.

Organism:: Mus musculus

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platforms:: GPL13112 GPL11002
20 Samples

Download data: BED

Series

Accession:: GSE47119

ID:: 200047119

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 2000467995.

Expression profile of Pten loss and ERG overexpression in mouse prostate

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected.

Organism:: Mus musculus

Type:: Expression profiling by array

Platform:: GPL6887
14 Samples

Download data: TXT

Series

Accession:: GSE46799

ID:: 200046799

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 2000463296.

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

(Submitter supplied) Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. more...

Organism:: Homo sapiens

Type:: Expression profiling by array

Platform:: GPL6947
9 Samples

Download data: TXT

Series

Accession:: GSE46329

ID:: 200046329

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 2000988097.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [VCaP ChIP-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL16791
11 Samples

Download data: BED

Series

Accession:: GSE98809

ID:: 200098809

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 2000988088.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [Organoids ChIP-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Mus musculus

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL17021
8 Samples

Download data: BED

Series

Accession:: GSE98808

ID:: 200098808

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 2000836539.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:: Mus musculus; Homo sapiens

Type:: Expression profiling by high throughput sequencing; Genome binding/occupancy profiling by high throughput sequencing

Platforms:: GPL16791 GPL20301 GPL17021
59 Samples

Download data: BED

Series

Accession:: GSE83653

ID:: 200083653

PubMed Full text in PMC Similar studies

Select item 20008365210.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [VCaP RNA-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Homo sapiens

Type:: Expression profiling by high throughput sequencing

Platform:: GPL16791
24 Samples

Download data: TXT

Series

Accession:: GSE83652

ID:: 200083652

PubMed Full text in PMC Similar studies Analyze with GEO2R SRA Run Selector

Select item 20008365111.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [Organoids RNA-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Mus musculus

Type:: Expression profiling by high throughput sequencing

Platform:: GPL17021
4 Samples

Download data: TXT

Series

Accession:: GSE83651

ID:: 200083651

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 20008364912.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [22PC RNA-seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Homo sapiens

Type:: Expression profiling by high throughput sequencing

Platform:: GPL20301
12 Samples

Download data: TXT

Series

Accession:: GSE83649

ID:: 200083649

PubMed Full text in PMC Similar studies Analyze with GEO2R SRA Run Selector

Select item 20003938813.

Distinct transcriptional programs controlled by ERG and ETV1 in prostate cells

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:: Mus musculus; Homo sapiens

Type:: Expression profiling by array; Genome binding/occupancy profiling by genome tiling array

Platforms:: GPL1261 GPL5082 GPL570
43 Samples

Download data: BAR, BED, CEL

Series

Accession:: GSE39388

ID:: 200039388

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20003935714.

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. more...

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by genome tiling array

Platform:: GPL5082
2 Samples

Download data: BAR, BED, CEL

Series

Accession:: GSE39357

ID:: 200039357

PubMed Full text in PMC Similar studies

Select item 20003935515.

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine mouse prostate cells from WT mice with s with T-ETV1 mice, which contains express the truncated human ETV1 under the endogenous Tmprss2 promoter. ETV1 expression can be tracked by GFP expression.

Organism:: Mus musculus

Type:: Expression profiling by array

Platform:: GPL1261
7 Samples

Download data: CEL

Series

Accession:: GSE39355

ID:: 200039355

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20003935416.

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions.

Organism:: Homo sapiens

Type:: Expression profiling by array

Platform:: GPL570
24 Samples

Download data: CEL

Series

Accession:: GSE39354

ID:: 200039354

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20003935317.

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell.

Organism:: Homo sapiens

Type:: Expression profiling by array

Platform:: GPL570
10 Samples

Download data: CEL

Series

Accession:: GSE39353

ID:: 200039353

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20015741318.

ERG-mediated coregulator complex formation maintains androgen receptor signaling in prostate cancer

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:: Mus musculus

Type:: Expression profiling by high throughput sequencing; Genome binding/occupancy profiling by high throughput sequencing

Platforms:: GPL21103 GPL19057
70 Samples

Download data: BW

Series

Accession:: GSE157413

ID:: 200157413

PubMed Similar studies

Select item 20015741019.

ERG-mediated coregulator complex formation maintains androgen receptor signaling in prostate cancer [single cell RNA-seq]

(Submitter supplied) We report the effects of ERG on prostate tumorigenesis, ERG-mediated oncogene addiction, and downstream AR signaling pathways. We determined that ERG facilitates AR-signaling and mediates transformation of prostate cells by maintaining coregulator complex formation at AR-bound sites across the genome.

Organism:: Mus musculus

Type:: Expression profiling by high throughput sequencing

Platform:: GPL21103
4 Samples

Download data: CLOUPE

Series

Accession:: GSE157410

ID:: 200157410

PubMed Similar studies SRA Run Selector

Select item 20015740920.

ERG-mediated coregulator complex formation maintains androgen receptor signaling in prostate cancer [Bulk RNA-seq]

(Submitter supplied) We report the effects of ERG on prostate tumorigenesis, ERG-mediated oncogene addiction, and downstream AR signaling pathways. We determined that ERG facilitates AR-signaling and mediates transformation of prostate cells by maintaining coregulator complex formation at AR-bound sites across the genome.

Organism:: Mus musculus

Type:: Expression profiling by high throughput sequencing

Platform:: GPL19057
16 Samples

Download data: BW

Series

Accession:: GSE157409

ID:: 200157409

PubMed Similar studies SRA Run Selector

GEO DataSets

Functional Genomics Studies

Result Filters

Entry type

Organism

Study type

Author

Attribute name

Publication dates

Custom date range

Additional filters

Send to:

Links from GEO DataSets

Items: 20

Send to:

Supplemental Content

Find related data

Important Links

Recent activity