Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO DataSets

Items: 20

1.

Response to catration in PTEN null and PTEN null ERG expressing mouse prostates

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration.
Organism:
Mus musculus
Type:
Expression profiling by array
Platform:
GPL6885
8 Samples
Download data: TXT
Series
Accession:
GSE46360
ID:
200046360
2.

ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.
Organism:
Homo sapiens; Mus musculus
Type:
Expression profiling by array; Genome binding/occupancy profiling by high throughput sequencing
6 related Platforms
56 Samples
Download data: BED
Series
Accession:
GSE47220
ID:
200047220
3.

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.
Organism:
Homo sapiens
Type:
Genome binding/occupancy profiling by high throughput sequencing
Platform:
GPL10999
5 Samples
Download data: BED
Series
Accession:
GSE47120
ID:
200047120
4.

Genomic mapping of ERG, AR, histone H3 monomethyl-K4, histone H3 trimethyl-K4 binding sites in mouse prostates in WT, ERG overexpression, Pten loss mouse prostates

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. We generated a mouse model of ERG ovexpression (Rosa26-ERG) which when crossed into prostate specific probasin-Cre, expressed ERG specifically in the prostate. We crossed Rosa26-ERG into Pten flox/flox allele to generate compound GEMM mouse. Here, we determined the genomic binding sites of ERG, AR, and the histone marks H3K4me1 and H3K4me3 that maps enhancers and promoters respectively in the prostates of these mice.
Organism:
Mus musculus
Type:
Genome binding/occupancy profiling by high throughput sequencing
Platforms:
GPL13112 GPL11002
20 Samples
Download data: BED
Series
Accession:
GSE47119
ID:
200047119
5.

Expression profile of Pten loss and ERG overexpression in mouse prostate

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected.
Organism:
Mus musculus
Type:
Expression profiling by array
Platform:
GPL6887
14 Samples
Download data: TXT
Series
Accession:
GSE46799
ID:
200046799
6.

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

(Submitter supplied) Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. more...
Organism:
Homo sapiens
Type:
Expression profiling by array
Platform:
GPL6947
9 Samples
Download data: TXT
Series
Accession:
GSE46329
ID:
200046329
7.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [VCaP ChIP-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...
Organism:
Homo sapiens
Type:
Genome binding/occupancy profiling by high throughput sequencing
Platform:
GPL16791
11 Samples
Download data: BED
Series
Accession:
GSE98809
ID:
200098809
8.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [Organoids ChIP-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...
Organism:
Mus musculus
Type:
Genome binding/occupancy profiling by high throughput sequencing
Platform:
GPL17021
8 Samples
Download data: BED
Series
Accession:
GSE98808
ID:
200098808
9.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.
Organism:
Mus musculus; Homo sapiens
Type:
Expression profiling by high throughput sequencing; Genome binding/occupancy profiling by high throughput sequencing
Platforms:
GPL20301 GPL17021 GPL16791
59 Samples
Download data: BED
Series
Accession:
GSE83653
ID:
200083653
10.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [VCaP RNA-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...
Organism:
Homo sapiens
Type:
Expression profiling by high throughput sequencing
Platform:
GPL16791
24 Samples
Download data: TXT
Series
Accession:
GSE83652
ID:
200083652
11.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [Organoids RNA-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...
Organism:
Mus musculus
Type:
Expression profiling by high throughput sequencing
Platform:
GPL17021
4 Samples
Download data: TXT
Series
Accession:
GSE83651
ID:
200083651
12.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [22PC RNA-seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...
Organism:
Homo sapiens
Type:
Expression profiling by high throughput sequencing
Platform:
GPL20301
12 Samples
Download data: TXT
Series
Accession:
GSE83649
ID:
200083649
13.

Distinct transcriptional programs controlled by ERG and ETV1 in prostate cells

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.
Organism:
Mus musculus; Homo sapiens
Type:
Expression profiling by array; Genome binding/occupancy profiling by genome tiling array
Platforms:
GPL1261 GPL570 GPL5082
43 Samples
Download data: BAR, BED, CEL
Series
Accession:
GSE39388
ID:
200039388
14.

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. more...
Organism:
Homo sapiens
Type:
Genome binding/occupancy profiling by genome tiling array
Platform:
GPL5082
2 Samples
Download data: BAR, BED, CEL
Series
Accession:
GSE39357
ID:
200039357
15.

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine mouse prostate cells from WT mice with s with T-ETV1 mice, which contains express the truncated human ETV1 under the endogenous Tmprss2 promoter. ETV1 expression can be tracked by GFP expression.
Organism:
Mus musculus
Type:
Expression profiling by array
Platform:
GPL1261
7 Samples
Download data: CEL
Series
Accession:
GSE39355
ID:
200039355
16.

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions.
Organism:
Homo sapiens
Type:
Expression profiling by array
Platform:
GPL570
24 Samples
Download data: CEL
Series
Accession:
GSE39354
ID:
200039354
17.

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

(Submitter supplied) Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell.
Organism:
Homo sapiens
Type:
Expression profiling by array
Platform:
GPL570
10 Samples
Download data: CEL
Series
Accession:
GSE39353
ID:
200039353
18.

Analysis of ETS gene expression patterns uncovers novel ETS mediated gene silencing pathways in prostate cancers

(Submitter supplied) Deregulated expression of ETS transcription factors with oncogenic and tumor suppressor function occurs frequently in prostate cancer leading to profound alterations of the cancer transcriptome. By integrating genomic and functional studies we identified key targets of the aberrantly expressed ETS factors, ERG and ESE3. Altered expression of ETS factors led to the induction of the polycomb group protein EZH2 and silencing of the tumor suppressor Nkx3.1. more...
Organism:
Homo sapiens
Type:
Expression profiling by array
Platform:
GPL887
67 Samples
Download data: TXT
Series
Accession:
GSE14206
ID:
200014206
19.

ERG-mediated coregulator complex formation maintains androgen receptor signaling in prostate cancer

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.
Organism:
Mus musculus
Type:
Expression profiling by high throughput sequencing; Genome binding/occupancy profiling by high throughput sequencing
Platforms:
GPL19057 GPL21103
70 Samples
Download data: BW
Series
Accession:
GSE157413
ID:
200157413
20.

ERG-mediated coregulator complex formation maintains androgen receptor signaling in prostate cancer [single cell RNA-seq]

(Submitter supplied) We report the effects of ERG on prostate tumorigenesis, ERG-mediated oncogene addiction, and downstream AR signaling pathways. We determined that ERG facilitates AR-signaling and mediates transformation of prostate cells by maintaining coregulator complex formation at AR-bound sites across the genome.
Organism:
Mus musculus
Type:
Expression profiling by high throughput sequencing
Platform:
GPL21103
4 Samples
Download data: CLOUPE
Series
Accession:
GSE157410
ID:
200157410
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

db=gds|term=|query=1|qty=3|blobid=MCID_617558795994c039eb646e04|ismultiple=true|min_list=5|max_list=20|def_tree=20|def_list=|def_view=|url=/Taxonomy/backend/subset.cgi?|trace_url=/stat?
   Taxonomic Groups  [List]
Tree placeholder
    Top Organisms  [Tree]

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center