Similar studies for GEO DataSets (Select 200083652) - GEO DataSets

Select item 2000836521.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [VCaP RNA-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Homo sapiens

Type:: Expression profiling by high throughput sequencing

Platform:: GPL16791
24 Samples

Download data: TXT

Series

Accession:: GSE83652

ID:: 200083652

PubMed Full text in PMC Similar studies Analyze with GEO2R SRA Run Selector

Select item 2000988092.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [VCaP ChIP-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL16791
11 Samples

Download data: BED

Series

Accession:: GSE98809

ID:: 200098809

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 2000988083.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [Organoids ChIP-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Mus musculus

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL17021
8 Samples

Download data: BED

Series

Accession:: GSE98808

ID:: 200098808

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 2000836534.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:: Mus musculus; Homo sapiens

Type:: Expression profiling by high throughput sequencing; Genome binding/occupancy profiling by high throughput sequencing

Platforms:: GPL16791 GPL20301 GPL17021
59 Samples

Download data: BED

Series

Accession:: GSE83653

ID:: 200083653

PubMed Full text in PMC Similar studies

Select item 2000836515.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [Organoids RNA-Seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Mus musculus

Type:: Expression profiling by high throughput sequencing

Platform:: GPL17021
4 Samples

Download data: TXT

Series

Accession:: GSE83651

ID:: 200083651

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 2000836496.

Loss of Function Mutations in ETS2 Repressor Factor (ERF) Reveal a Balance Between Positive and Negative ETS Factors Controlling Prostate Oncogenesis [22PC RNA-seq]

(Submitter supplied) Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. more...

Organism:: Homo sapiens

Type:: Expression profiling by high throughput sequencing

Platform:: GPL20301
12 Samples

Download data: TXT

Series

Accession:: GSE83649

ID:: 200083649

PubMed Full text in PMC Similar studies Analyze with GEO2R SRA Run Selector

Select item 2001106577.

Binding of TMPRSS2-ERG to BAF Chromatin Remodeling Complexes Mediates Prostate Oncogenesis.

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by high throughput sequencing; Expression profiling by high throughput sequencing

Platform:: GPL18573
50 Samples

Download data: BROADPEAK, NARROWPEAK, TXT

Series

Accession:: GSE110657

ID:: 200110657

PubMed Full text in PMC Similar studies

Select item 2001106568.

Binding of TMPRSS2-ERG to BAF Chromatin Remodeling Complexes Mediates Prostate Oncogenesis. [RNA-seq]

(Submitter supplied) Chromosomal rearrangements resulting in the fusion of TMRPSS2, an androgen-regulated gene, and the ETS family transcription factor ERG occur in over half of prostate cancers. However, the mechanism by which ERG promotes oncogenic gene expression and proliferation remains incompletely understood. Here, we identify a binding interaction between ERG and the mammalian SWI/SNF (BAF) ATP-dependent chromatin remodeling complex, which is conserved among other ETS factors, including ETV1, ETV4, and ETV5. more...

Organism:: Homo sapiens

Type:: Expression profiling by high throughput sequencing

Platform:: GPL18573
24 Samples

Download data: TXT

Series

Accession:: GSE110656

ID:: 200110656

PubMed Full text in PMC Similar studies Analyze with GEO2R SRA Run Selector

Select item 2001106559.

Binding of TMPRSS2-ERG to BAF Chromatin Remodeling Complexes Mediates Prostate Oncogenesis.[ChIP-seq]

(Submitter supplied) Chromosomal rearrangements resulting in the fusion of TMRPSS2, an androgen-regulated gene, and the ETS family transcription factor ERG occur in over half of prostate cancers. However, the mechanism by which ERG promotes oncogenic gene expression and proliferation remains incompletely understood. Here, we identify a binding interaction between ERG and the mammalian SWI/SNF (BAF) ATP-dependent chromatin remodeling complex, which is conserved among other ETS factors, including ETV1, ETV4, and ETV5. more...

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL18573
26 Samples

Download data: BROADPEAK, NARROWPEAK

Series

Accession:: GSE110655

ID:: 200110655

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 20004722010.

ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:: Homo sapiens; Mus musculus

Type:: Expression profiling by array; Genome binding/occupancy profiling by high throughput sequencing

6 related Platforms
56 Samples

Download data: BED

Series

Accession:: GSE47220

ID:: 200047220

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20004712011.

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL10999
5 Samples

Download data: BED

Series

Accession:: GSE47120

ID:: 200047120

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 20004711912.

Genomic mapping of ERG, AR, histone H3 monomethyl-K4, histone H3 trimethyl-K4 binding sites in mouse prostates in WT, ERG overexpression, Pten loss mouse prostates

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. We generated a mouse model of ERG ovexpression (Rosa26-ERG) which when crossed into prostate specific probasin-Cre, expressed ERG specifically in the prostate. We crossed Rosa26-ERG into Pten flox/flox allele to generate compound GEMM mouse. Here, we determined the genomic binding sites of ERG, AR, and the histone marks H3K4me1 and H3K4me3 that maps enhancers and promoters respectively in the prostates of these mice.

Organism:: Mus musculus

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platforms:: GPL13112 GPL11002
20 Samples

Download data: BED

Series

Accession:: GSE47119

ID:: 200047119

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 20004679913.

Expression profile of Pten loss and ERG overexpression in mouse prostate

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected.

Organism:: Mus musculus

Type:: Expression profiling by array

Platform:: GPL6887
14 Samples

Download data: TXT

Series

Accession:: GSE46799

ID:: 200046799

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20004636014.

Response to catration in PTEN null and PTEN null ERG expressing mouse prostates

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration.

Organism:: Mus musculus

Type:: Expression profiling by array

Platform:: GPL6885
8 Samples

Download data: TXT

Series

Accession:: GSE46360

ID:: 200046360

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20004632915.

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

(Submitter supplied) Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. more...

Organism:: Homo sapiens

Type:: Expression profiling by array

Platform:: GPL6947
9 Samples

Download data: TXT

Series

Accession:: GSE46329

ID:: 200046329

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 20021631816.

The CIC-ERF co-deletion underlies fusion independent activation of ETS family member, ETV1, to drive prostate cancer progression.

(Submitter supplied) Methods: To characterize the expression profile of ERF-CIC deleted prostate cells, we performed single-cell RNA-sequencing of PNT2 ERF knock down and CIC knockout cell line. Results: We found that CIC and ERF loss were significantly associated with the ETV1-regulated gene set but was anti-correlated with the TMPRSS2-ERG fusion signature gene set. The enrichment gene signature of ERF-CIC dual loss was similar to ERF loss alone and ETV1-regulated gene set signature. more...

Organism:: Homo sapiens

Type:: Expression profiling by high throughput sequencing

Platform:: GPL20301
8 Samples

Download data: TSV

Series

Accession:: GSE216318

ID:: 200216318

PubMed Full text in PMC Similar studies

Select item 20007912817.

AR and ERG ChIP-seq in presence or absence of PRMT5

(Submitter supplied) Replicates of ChIP seq data using AR and ERG antibodies from VCaP cell lines harboring inducible shRNA constructs for PRMT5 (3 independent, sh1, sh2, sh3) and 1 non targeting control (NTC), all sample stimulated with ligand, either DHT or R1881

Organism:: Homo sapiens

Type:: Genome binding/occupancy profiling by high throughput sequencing

Platform:: GPL18573
26 Samples

Download data: BED, TXT

Series

Accession:: GSE79128

ID:: 200079128

PubMed Full text in PMC Similar studies SRA Run Selector

Select item 20022647218.

A complex with poly(A) binding protein cytoplasmic 1 and EWS facilitates oncogenic ETS transcription factor function in prostate cells

(Submitter supplied) The ETS transcription factor ERG is aberrantly expressed in approximately 50% of prostate tumors due to chromosomal rearrangements such as TMPRSS2/ERG. The ability of ERG to drive oncogenesis in prostate epithelial cells requires interaction with distinct co-activators, such as the RNA-binding protein EWS. Here, we find that ERG has both direct and indirect interactions with EWS, and the indirect interaction is mediated by the poly-A RNA-binding protein PABPC1. more...