Format
Items per page
Sort by

Send to:

Choose Destination

Links from PMC

Items: 6

1.

ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.
Organism:
Homo sapiens; Mus musculus
Type:
Expression profiling by array; Genome binding/occupancy profiling by high throughput sequencing
6 related Platforms
56 Samples
Download data: BED
Series
Accession:
GSE47220
ID:
200047220
2.

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.
Organism:
Homo sapiens
Type:
Genome binding/occupancy profiling by high throughput sequencing
Platform:
GPL10999
5 Samples
Download data: BED
Series
Accession:
GSE47120
ID:
200047120
3.

Genomic mapping of ERG, AR, histone H3 monomethyl-K4, histone H3 trimethyl-K4 binding sites in mouse prostates in WT, ERG overexpression, Pten loss mouse prostates

(Submitter supplied) Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. We generated a mouse model of ERG ovexpression (Rosa26-ERG) which when crossed into prostate specific probasin-Cre, expressed ERG specifically in the prostate. We crossed Rosa26-ERG into Pten flox/flox allele to generate compound GEMM mouse. Here, we determined the genomic binding sites of ERG, AR, and the histone marks H3K4me1 and H3K4me3 that maps enhancers and promoters respectively in the prostates of these mice.
Organism:
Mus musculus
Type:
Genome binding/occupancy profiling by high throughput sequencing
Platforms:
GPL13112 GPL11002
20 Samples
Download data: BED
Series
Accession:
GSE47119
ID:
200047119
4.

Expression profile of Pten loss and ERG overexpression in mouse prostate

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected.
Organism:
Mus musculus
Type:
Expression profiling by array
Platform:
GPL6887
14 Samples
Download data: TXT
Series
Accession:
GSE46799
ID:
200046799
5.

Response to catration in PTEN null and PTEN null ERG expressing mouse prostates

(Submitter supplied) We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration.
Organism:
Mus musculus
Type:
Expression profiling by array
Platform:
GPL6885
8 Samples
Download data: TXT
Series
Accession:
GSE46360
ID:
200046360
6.

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

(Submitter supplied) Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. more...
Organism:
Homo sapiens
Type:
Expression profiling by array
Platform:
GPL6947
9 Samples
Download data: TXT
Series
Accession:
GSE46329
ID:
200046329
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

db=gds|term=|query=1|qty=3|blobid=MCID_61a81b677abcce1251505a10|ismultiple=true|min_list=5|max_list=20|def_tree=20|def_list=|def_view=|url=/Taxonomy/backend/subset.cgi?|trace_url=/stat?
   Taxonomic Groups  [List]
Tree placeholder
    Top Organisms  [Tree]

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center