Updating Information on GenBank Records
You can update your existing GenBank records at any time using the different file types described below. If you are updating multiple records, please send a list of all accessions to be updated at the top of your request. You can also request a change in the release date of your records, depending on their status. Save the update file types as plain text and mail to gb-admin@ncbi.nlm.nih.gov.
Do not submit a new file to update an existing record as this will create unnecessary duplication in the database.
If you submitted to our collaborators at ENA or DDBJ, please see their instructions for update formats. Prokaryotic and eukaryotic genomes, TSA and SRA should be updated as described on the linked pages. Updates to BioProject and BioSample should be sent to submit-help@ncbi.nlm.nih.gov.
Update Formats for GenBank Records:
Editing Source Information
Send updates to the source information (i.e. strain, cultivar, country, specimen_voucher) in a multi-column tab-delimited table, for example:
acc. num. strain country organism
MHxxxx02 82 USA Escherichia coli
MHxxxx03 ABC Canada Bacillus subtilis
Updating Publication Information
[a] If the PMID or DOI are publicly available please send the information as a tab-delimited table as follows:
acc. num. PMID
MHXXXX01 29980901
MHXXXX02 29980901
or
acc. num. DOI
MHXXXX01 10.1000/xyz123
MHXXXX02 https://0-doi-org.brum.beds.ac.uk/10.1000/xyz123doi
[b] For all other updates, please provide the revised information in a tab-delimited table. You must replace any non-ASCII characters (for example, characters with accents and umlauts) with the appropriate English letters.
The complete list of revised author names should be provided in the following format: first_initial middle_initial surname, etc., For example:
acc. num. authors title
MHXXXX01 J. A. Smith Identification of gene A
MHXXXX02 X. P. Weng, J. Doe Identification of gene B
These are the valid publication fields which should be used in the column headers:
- authors
- journal
- volume
- issue
- pages
- publication date
- title
- affiliation
- department
- city
- state
- publication country
- street
- postal code
- *PMID
- **class
All columns may not be appropriate for each reference. Use only the relevant columns. If the reference has been published, include the complete journal title, not an abbreviation.
*If the publication has a PubMed identifier (PMID), it is not necessary to supply any of the remaining publication fields. It is sufficient to send a table with accession number and PMID only.
**The class descriptor should only be used when the publication status has been changed. This descriptor has a controlled vocabulary and may only include one of the following three class values:
- unpublished
- in-press journal
- journal
Nucleotide Sequence Update
If you are updating the current nucleotide sequence send the complete new sequence(s) in fasta format:
>MHxxxx02
cggtaataatggaccttggaccccggcaaagcggagagac
>MHxxxx03
ggaccttggaccccggcaaagcggagagaccggtaataat
Please do not send a list of nucleotide changes. Do not include non-IUPAC characters within the sequence. Use n's for unknown nucleotides within the sequence.
Feature Update
If you are adding annotation or changing locations of features, then send us the features as a tab-delimited 5-column Feature table.
a. If the record is publicly released and has annotation, you can download the existing annotation .tbl file by retrieving the record and clicking on the 'Send to' option. Choose 'File' as Destination and then Format 'Feature table'. Edit this table and send to us via email.
b. If the record is not yet publicly released, let us know, and we will send you a 5-column table with the current annotation for you to edit and return to us.
Please maintain the tab structure of the table when editing.
For example:
>Feature gb|EFxxxxxx|EFxxxxxx
<1 400 gene
gene ENO1
<1 30 CDS
70 300
product enolase
note homodimer
<1 30 mRNA
70 400
product enolase
<1 30 exon
number 1
70 400 exon
number 2