NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10787 Query DataSets for GPL10787
Status Public on Nov 30, 2010
Title Agilent-028005 SurePrint G3 Mouse GE 8x60K Microarray (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site www.chem.agilent.com
Catalog number G4852A
 
Description SurePrint G3 Mouse GE 8x60K Microarray
Glass slide formatted with eight high-definition 60K arrays
Includes probes for mRNAs and lincRNAs (long intergenic non-coding RNAs)
60-mer oligo probes

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL13912.
 
Submission date Aug 12, 2010
Last update date Feb 02, 2018
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (9811) GSM578523, GSM578524, GSM578525, GSM578526, GSM578527, GSM578528 
Series (652)
GSE23585 Neural stem and progenitor cells shorten S-phase upon commitment to neuron production
GSE28369 Expression data from LSK mice that overpexpress Ezh2 versus LSK Control
GSE30279 ESlncRNA (AK148461) over-expression on gene expression
Relations
Alternative to GPL13912

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
(+)E1A_r60_1 (+)E1A_r60_1 pos
(+)E1A_r60_3 (+)E1A_r60_3 pos
(+)E1A_r60_a104 (+)E1A_r60_a104 pos
(+)E1A_r60_a107 (+)E1A_r60_a107 pos
(+)E1A_r60_a135 (+)E1A_r60_a135 pos
(+)E1A_r60_a20 (+)E1A_r60_a20 pos
(+)E1A_r60_a22 (+)E1A_r60_a22 pos
(+)E1A_r60_a97 (+)E1A_r60_a97 pos
(+)E1A_r60_n11 (+)E1A_r60_n11 pos
(+)E1A_r60_n9 (+)E1A_r60_n9 pos
3xSLv1 3xSLv1 neg
A_30_P01017425 A_30_P01017425 FALSE chr8:119735533-119736887_F chr8:119736004-119736063 mm|8qE1 lincRNA:chr8:119735533-119736887 forward strand GACCCTTCCCAGGGTGCCTCATGGTCCGGCTTTCCCTAACAGTCCTTAATTCCCAGAGAT
A_30_P01017426 A_30_P01017426 FALSE chr10:83325890-83402790_R chr10:83364773-83364714 mm|10qC1 lincRNA:chr10:83325890-83402790 reverse strand TCTGATTTTCTTCAGCCACTCCAGGTCCTCACACAGGTTGCTGTCTAGACCATTGGCCAG
A_30_P01017427 A_30_P01017427 FALSE chr5:30550467-30559008_R chr5:30558727-30558668 mm|5qB1 lincRNA:chr5:30550467-30559008 reverse strand TGAAAATCAGTCCCTTCTGATCCATGATGCTTGTGAACCTTGGACTGCCTCGTCAAATTC
A_30_P01017428 A_30_P01017428 FALSE chr9:88338621-88338923_F chr9:88338864-88338923 mm|9qE3.1 lincRNA:chr9:88338621-88338923 forward strand AGTCAACTTAGACAAGTACTAGCAGATTTCCACATAAGAAATCAAACAAGACTTGGGGGA
A_30_P01017429 A_30_P01017429 FALSE chr18:13114367-13118513_F chr18:13118138-13118197 mm|18qA1 lincRNA:chr18:13114367-13118513 forward strand ATCTGAGGTCTGCGACCTGTGATCTTGAGATGTTTCAACTCTTTGAACTGTTCTGGAGAC
A_30_P01017430 A_30_P01017430 FALSE chr3:85589154-85621215_R chr3:85621153-85621094 mm|3qF1 lincRNA:chr3:85589154-85621215 reverse strand CTGAAAGGTGAAGCAAACAAATACAACCCAACAGTGTGCTACTGAAGAAAGCATTCACAG
A_30_P01017431 A_30_P01017431 FALSE chr11:102983499-102994170_F chr11:102993470-102993529 mm|11qE1 lincRNA:chr11:102983499-102994170 forward strand AATTTCCAAGCGCTAAGCTCGAGCTTTCCACGTGCCCAGATCTAGTTGGTCCCAGGGGGA
A_30_P01017432 A_30_P01017432 FALSE chr2:168804720-168854970_R chr2:168832661-168832602 mm|2qH3 lincRNA:chr2:168804720-168854970 reverse strand CTTGTTCAGGTCCCTCTTCTCCTGGCTCCTGAGAGACAGGAAATGGGATAGAAACTACTC
A_30_P01017433 A_30_P01017433 FALSE chr5:34696192-34722842_F chr5:34712570-34712629 mm|5qB2 lincRNA:chr5:34696192-34722842 forward strand AACTGGGATCCCTTTCCCCTTGTGTCCGCCATATTGGACTCTTAACTCTGGTCAGCGGCG

Total number of rows: 55821

Table truncated, full table size 28136 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap