NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL13397 Query DataSets for GPL13397
Status Public on Apr 13, 2011
Title Agilent-015347 Regeneron Custom Whole Genome Oligo - mouse v1.0
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol See manufacturer's web site at http://www.agilent.com
 
 
Submission date Apr 11, 2011
Last update date Apr 13, 2011
Contact name Ivan B Lobov
E-mail(s) Ivan.Lobov@regeneron.com
Organization name Regeneron Pharmaceuticals
Department Regeneron Pharmaceuticals
Street address 777 Old Saw Mill River Road,
City Tarrytown
State/province NY
ZIP/Postal code 10591
Country USA
 
Samples (16) GSM706354, GSM706355, GSM706356, GSM706357, GSM706358, GSM706359 
Series (1)
GSE28516 Expression analysis of mouse retinas after treatment with VEGF-A or Dll4-Fc.

Data table header descriptions
ID
SEQUENCE
ORF_LIST
GB_LIST
Description Gene description

Data table
ID SEQUENCE ORF_LIST GB_LIST Description
A_51_P100034 GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG Mif4gd NM_027162, NR_029442 Mus musculus MIF4G domain containing (Mif4gd), mRNA
A_51_P100052 CTAAATGTGAATTGCCAAGAAAGGAAGTTCACTAACATCTCTGACCTACAGCCCAAACCT Slitrk2 NM_001161431, NM_198863 Mus musculus SLIT and NTRK-like family, member 2 (Slitrk2), mRNA
A_51_P100063 GAAGAATCAGATGTGGTGACATTCTTCTCGCTGTCAACGGTAGAAGTACATCGGGTATGA Lnx1 NM_001159580, NM_001159577, NM_010727, NM_001159579, NM_001159578 Mus musculus ligand of numb-protein X 1 (Lnx1), mRNA
A_51_P100065 TTTTTTATCAAGTCCATTGTTGAAGGAACACCTGCATACAATGACGGAAGAATCAGATGT Lnx1 NM_001159580, NM_001159577, NM_010727, NM_001159579, NM_001159578 Mus musculus ligand of numb-protein X 1 (Lnx1), mRNA
A_51_P100084 AAGTCATCTCTCATGCCTATCAGAATACTCTGCCTCTAAGCCCAAATCAACATCTTAAAA Mus musculus RIKEN cDNA 1700054H16 gene (1700054H16Rik) on chromosome 11
A_51_P100099 TTTTGTTGTTTTACTTACAGCATATGTTCTGGTGATTGAAAACCAAACAGTTATGGAGGG
A_51_P100101 ATTGTGCAGAGTTCTCTGGGGATGGCTGGAATGATCTCAGTTGTGATAAACTACTTTTCT Cd209d NM_130904 Mus musculus CD209d antigen (Cd209d), mRNA
A_51_P100123 TGATGCAGACTCTTGGAAACCTCAGAAACGCATGGTGACGATATGACCAAGAATCTTCCT
A_51_P100155 TACGAAGGGGTCCACAAGCCACGGGAAATGGATACAAGTCGAAGGAAATTCCACTTATAA Rpf1 NM_027371 Mus musculus brix domain containing 5 (Bxdc5), transcript variant 2, mRNA
A_51_P100174 CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT Mns1 NM_008613 Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA
A_51_P100180 TGGTGTGATTCAAATGTCTTCTGATAACTTGATGTTATTTGGAGGAGTTCAGTAAGATTG Mus musculus mediator complex subunit 14 (Med14), transcript variant 1, mRNA
A_51_P100208 TTTGGGTTTTCTTTGGCATAAACCTTATTTCTAGAAATCCTCATGTCCAATTGCTTTCCC Opcml NM_177906 Mus musculus opioid binding protein/cell adhesion molecule-like (Opcml), mRNA
A_51_P100227 GATCCAAACGTTTTGGCTTAGGATTTCCATTGCAGATTGTAATTGCTTTAGAGACACACG Ipo5 NM_023579 Mus musculus RAN binding protein 5 (Ranbp5), mRNA
A_51_P100238 GGACCATGATCTCCATGTATGTGCGCCCAAATGCACATCTGTCACCGGAACTCAACAAGG Olfr323 NM_146376 Mus musculus olfactory receptor 323 (Olfr323), mRNA
A_51_P100246 AGTCCTTACGATAAACTCCATAATTTATGGCCTGCAGTATCTCTTCTTGGAGCCGAACCC Ube2m NM_145578, NM_001168469 Mus musculus ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), mRNA
A_51_P100289 GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT Srf NM_020493 Mus musculus serum response factor (Srf), mRNA
A_51_P100296 ATTATCATTGTGGTAGTAGTTGTGTTGCTGGGCATTTTAGCGTTGATTATTGGACTGTCC Stx3 NM_152220 Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA
A_51_P100298 ATCGCCATGCTGGTGGAAAATCAGGGGGAGATGTTAGATAACATAGAGTTGAATGTCATG Stx3 NM_152220 Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA
A_51_P100309 GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT Oprm1 NM_001039652 Mus musculus opioid receptor, mu 1 (Oprm1), mRNA
A_51_P100312 TGGCTGTATTTATTGTCTGCTGGACCCCCATCCACATCTATGTCATCATCAAAGCACTGA Oprm1 NM_001039652 Mus musculus opioid receptor, mu 1 (Oprm1), mRNA

Total number of rows: 43225

Table truncated, full table size 6052 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap