GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Platform GPL13497

Query DataSets for GPL13497

Status

Public on May 05, 2011

Title

Agilent-026652 Whole Human Genome Microarray 4x44K v2 (Probe Name version)

Technology type

in situ oligonucleotide

Distribution

commercial

Organism

Homo sapiens

Manufacturer

Agilent Technologies

Manufacture protocol

see manufacturer's web site at http://www.agilent.com/

Description

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL10332.

Submission date

May 05, 2011

Last update date

Jan 09, 2018

Organization

Agilent Technologies

E-mail(s)

cag_sales-na@agilent.com

Phone

877-424-4536

URL

http://www.agilent.com

Department

Street address

City

Palo Alto

State/province

ZIP/Postal code

94304

Country

USA

Samples (7903)

More...

GSM636910, GSM636911, GSM636912, GSM636913, GSM720948, GSM720949

Series (416)

More...

GSE25931	Gene Expression Profiling of Human Embryonic Neural Stem Cells and Dopaminergic Neurons from Adult Human Substantia Nigra
GSE29106	Microarray Profile of Measles Virus Nucleocapsid Protein (MVNP) Regulated Gene Expression in RANKL and M-CSF stimulated normal human bone marrow derived non-adherent cells.
GSE29107	Microarray profile of p62P392L-regulated gene expression in RANKL and M-CSF stimulated normal human bone marrow derived non-adherent cells

GSE30774	Iron excess limits HHIPL2 gene expression and decreases osteoblastic activity in human MG-63 cells
GSE31023	Molecular characterisation of circulating tumor cells in human metastatic colorectal cancer
GSE31751	Regulation of gene expression by mir-493
GSE35535	TIMP1 overexpression mediates resistance of MCF-7 human breast cancer cells to fulvestrant and down-regulates progesterone receptor expression
GSE35764	Polyphenols protection against fructose overload
GSE37143	Gene expression induced by 5SA-Atoh1 in DLD1 cells
GSE38476	Investigation of the gene expression pattern of human hepatocellular carcinoma (HCC) infiltrating γδT cells
GSE39207	DDR1 knockdown in BXPC3 cell line
GSE40018	Expression data from 34 Synovial Sarcomas
GSE40025	Expression data from Synovial Sarcomas
GSE40355	Bladder cancer: analysis of miRNA-mRNA interactions
GSE40774	Integrative genomic analysis identifies clinically relevant subtypes of head and neck cancer characterized by hypoxia, T-cell infiltration, and EMT
GSE41101	Gene expression profiles in human alveolar epithelial cell line exposure to impurity-free single-wall carbon nanotubes
GSE41495	Gene expression analysis of human oral squamous cell carcinoma cell lines (HSC-4, OSC19)
GSE42112	Comparison of extravillous trophoblast cells derived from human embryonic stem cells and from first trimester human placentas
GSE42512	Human HAK-1A hepatocellular carcinoma (HCC) cells: TCF-4J-overexpressing clone (under normoxia) vs. TCF-4K-overexpressing clone (under normoxia)
GSE42632	mRNA expression profile of dermal MSCs derived from psoriasis patients and normal control
GSE42736	Effect of synbindin on the gene expression profile of gastric cancer cells
GSE43151	Characterization of gene expression profiles at low and very low doses of ionizing radiation
GSE43990	Modulator of Apoptosis 1 (MOAP-1) is a highly regulated tumor suppressor protein
GSE44032	Comparing gene expression of human cardiac stem cells between automatic cell culture and manual handling culture
GSE44099	NAC, Tiron and Trolox impair GBM tumorigenic cell survival by mechanisms independent from antioxidant activity
GSE44207	CCAAT/enhancer-binding protein alpha is epigenetically silenced by histone acetylation in endometriosis and promotes the pathogenesis of endometriosis: a novel therapeutic target
GSE44397	Network Understanding of SNAIL inhibitor induced perturbations in EMT models
GSE44559	Gene expression profiles of MAIT cells, MAIT-iPSCs, hiPSCs, hESCs, and reMAIT cells
GSE44766	Human tongue squamous cell carcinoma cell line SAS-Control vs. SAS-LYRIC knockdown stable clones global gene profiling
GSE45168	Overexpression of NEK6 Associated with Poor Prognosis of Esophageal Squamous Cell Carcinoma
GSE45224	Expression data from Disulfiram or 5-FU treated EpCAM-negative non-tumor-initiating hepatocellular carcinoma (HCC) cells.
GSE45458	Human ILC2 cells stimulated with IL-25, IL-33, or TSLP
GSE45502	Influence of the two different cryopreservation methods to inflammation of dental pulp cells
GSE45912	Apurinic/apyrimidinic endonuclease/redox factor-1 (Ape1/Ref-1) activates Notch signaling through Jagged1 expression and promotes colon cancer progression
GSE45980	An integrative analysis of renal miRNA- and mRNA-expression signatures in progressive chronic kidney disease [discovery cohort]
GSE46200	LGR5 positivity defines stem-like cells in colorectal cancer [Expression]
GSE46374	Inhibition of proliferation and induction of autophagy by atorvastatin in PC3 prostate cancer cells correlate with downregulation of Bcl2 and upregulation of miR-182 and p21 [Gene expression]
GSE46376	Inhibition of proliferation and induction of autophagy by atorvastatin in PC3 prostate cancer cells correlate with downregulation of Bcl2 and upregulation of miR-182 and p21
GSE46631	Vascularised and functional human liver from an iPSC-derived organ bud transplant
GSE46712	LGR5 positivity defines stem-like cells in colorectal cancer
GSE46856	PLK1 signaling coopereates with estrogen receptor-dependent gene transcription.
GSE47186	MiR-376c down-regulation accelerates EGF-dependent migration by targeting GRB2 in the HuCCT1 human intrahepatic cholangiocarcinoma cell line
GSE47538	Myeloid cells or lung fibroblasts treated with IL-4 or IL-13
GSE47553	Effect of progerin on p53-deficient vascular smooth muscle cells
GSE47797	Effect of Helicobacter pylori on ATM-dependent DNA damage responses
GSE48662	Cell senescence abrogates the immunomodulatory therapeutic potential of human mesenchymal stem cells
GSE49965	Changes of the gene expression profiling induced by fenofibrate
GSE50746	Time dependent changes of gene expression in surgical specimen of colorectal cancer
GSE51351	Marinobufagenin regulates gene expression in human brain microvascular endothelial cells in vitro.
GSE51390	The gene expression of aromatase-inhibitor-resistant cell line
GSE51588	Genome-wide Expression Profiles of Subchondral Bone in Osteoarthritis
GSE52505	High throughput screening of lipopolysaccharide treatment in nasal fibroblast
GSE52611	Gene expression in INA6 multiple myeloma cells in an acidic condition
GSE53318	Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts (Agilent 2-color)
GSE53319	Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts
GSE53402	Hypoxic conditioned medium from human amniotic fluid-derived mesenchymal stem cells accelerates skin wound healing through TGF-ß/SMAD and PI3K/Akt pathways
GSE53772	Translatome and transcriptome profiling of FK866 response in Jurkat cells
GSE54075	PADI4 acts as a coactivator of Tal1 by counteracting repressive histone arginine methylation at the IL6ST (gp130) promoter
GSE54127	Butyrate Induced Changes in Wnt Signaling-Specific Gene Expression in Colorectal Cancer Cells
GSE54187	Metastatic potential is determined early in synovial sarcoma development and reflected by tumor molecular features [transcriptome]
GSE54188	Metastatic potential is determined early in synovial sarcoma development and reflected by tumor molecular features
GSE54225	2',3,5-Trimethoxychalcone (MC-23)-induced gene expression in MiaPaCa2 cells
GSE54319	Microarray analysis of breast cancer cell lines with different levels of P-cadherin expression treated with the anti-cancer bacterial protein azurin
GSE55350	Modeling Luminal breast cancer heterogeneity: Combination therapy to suppress hormone receptor negative cells in Luminal disease
GSE55869	Radiation-induced bystander effects and gene expression in cells deficient for RAD9
GSE56005	A549, human alveolar adenocarcinoma cell, treated with aldehyde
GSE56234	Gene expression profiles of TiPS generated in a defined condition, ES and T cells
GSE56738	Gene expression profiles of colorectal cancer cells under the three dimensional culture
GSE56854	Compulsory expression of miR-210 in normal endometrial stromal cells
GSE57000	Microarray analysis of H460 parental and H460 holoclone (stem-like cell)-derived tumors
GSE57059	Differential Expression of Stress and Immune Response Pathway Transcripts and miRNAs in Normal Human Endothelial Cells Subjected to Fractionated or Single-Dose Radiation [mRNA]
GSE57060	Differential Expression of Stress and Immune Response Pathway Transcripts and miRNAs in Normal Human Endothelial Cells Subjected to Fractionated or Single-Dose Radiation
GSE57106	Human hepatocarcinoma cells : Huh-7 vs. SNU-739
GSE57568	ALKBH3 Knockdown in PC3 prostate cancer cells
GSE57736	Gene expression comparison between Mycobacterium tuberculosis infected monocytes from tuberculous and healthy elders
GSE58041	Activating c-KIT mutations confer oncogenic cooperativity and rescue RUNX1-ETO-induced DNA damage in human cells
GSE58059	Gene expression profile regulated by leptin
GSE58060	Comparision of gene expression in miR-17-92 cluster overexpression stable CCLP-1 cells with scrambled control CCLP-1 cells
GSE59347	mRNA expression profile in IL-4-treated macrophages transfected with miR-142-5p ASO or miR-130a-3p mimics
GSE59349	The differential miRNA expression induces M2 macrophage polarization and mediates their profibrogenic effects
GSE59476	Fibrocyte-like cells mediate acquired resistance to anti-angiogenic therapy with bevacizumab
GSE59834	Genes regulated by SET7/9 knockdown in gastric cancer cells
GSE59897	Expression profile of HCT116 cells transfected with miR-204-5p
GSE60139	Gene expressions in pancreatic cancer cells
GSE60662	Effect of Helicobacter pylori on ATM-dependent DNA damage responses [biopsy]
GSE60860	An integrative analysis of renal miRNA- and mRNA-expression signatures in progressive chronic kidney disease [validation cohort]
GSE60861	An integrative analysis of renal miRNA- and mRNA-expression signatures in progressive chronic kidney disease
GSE60867	Microarray analysis of human gene expression in metronomic cyclophosphamide-treated human glioma U251 xenografts implanted in scid mice
GSE60913	Gene expression in metronomic cyclophosphamide-treated glioma xenografts
GSE61356	Identification of gene expression signature of LILRA3 stimulation
GSE61455	Gene expression profile in Caco-2 cells treated with carnosine
GSE61547	Expression data from HTR-8/Svneo side population (SP) and non-side population (NSP) cells
GSE62235	IL6-STAT3 downstream targets in MCF10A/MCF10A.ErbB2* cells
GSE62251	Inhibition of the autocrine loop IL6-JAK2-STAT3-Calprotectin as targeted therapy for HR-/HER2+ breast cancers
GSE62320	Gene expression data from human oral squamous cell carcinoma cell-lines; OSC19 and OSC20
GSE62507	The long noncoding RNA SPRY4-IT1 increases the proliferation of human breast cancer cells by upregulating ZNF703 expression
GSE62933	Human hepatic stem cells transplanted into a fulminant hepatic failure Alb-TRECK/SCID mouse model exhibit liver reconstitution and drug metabolism capabilities
GSE62998	Hepatic stem cells with self-renewal and liver repopulation potential are harbored in CDCP1-positive subpopulations of human fetal liver cells
GSE64272	Impacts of reprogramming method and culture conditions in trophoblast differentiation of induced pluripotent stem cells
GSE64330	Gene expression profile of mock and FLT3-ITD-expressing K562 cells.
GSE64525	Development of gene set for IL-6-dependent RB inactivation signature
GSE64531	Human monocyte-derived macrophages polarized by GM-CSF (M1) or M-CSF (M2) in the presence or absence of 5 micromolar methotrexate
GSE64710	The identification of differentially downregulated genes in hypoxia or G9a overexpression
GSE64884	Maternal peripheral blood natural killer cells incorporate placenta-associated microRNAs during pregnancy
GSE64916	Gastric carcinoma patients and healthy subjects
GSE65292	Radiation dose-rate effects on gene expression for human biodosimetry
GSE65407	A Luminal, Steroid Receptor-Positive Breast Cancer Stem Cell that Generates Intratumoral Heterogeneity is Preserved by Progesterone and Depleted by Estradiol
GSE65413	Helveticoside was a biologically active component of seeds extract of Descurainia Sophia.
GSE65573	Immortalized Human Hepatocyte (IHH) transcriptome response to wild-type Ebola viruses Zaire Ebola (ZEBOV '76) and Reston Ebola (REBOV '08)
GSE65574	Human Calu-3 cell transcriptome response to a wild type infectious clone of Middle Eastern Respiratory Syndrome (icMERS) coronavirus and icMERS mutant viruses
GSE65575	Modeling Host Responses to Understand Severe Human Virus Infections
GSE65855	Therapeutic intervention of monocytes to LPS challenge
GSE66124	Epigenetic modification and antibody-dependent expansion of memory-like NK cells in human cytomegalovirus-infected individuals
GSE66450	Expression of genes in hepatic progenitor-like cells derived from human iPS cells
GSE66682	KSHV-infected invasive bladder cancer cell: Control vs. KSHV-infected
GSE66969	Gene expression profiles of human iPSC derived podocytes
GSE67643	Microarray analysis of gene expression profiles in human neuroblastoma SH-SY5Y cells exposed to norephedrine
GSE67747	Cultured human adipose tissue pericytes and mesenchymal stromal cells display a very similar gene expression profile
GSE68346	To investigate the alteration of gene expression profiles after NCSTN gene silencing in HaCaT cells employing Agilent whole genome microarray
GSE68563	Gene expression profile in HIV-1 and HIV-2 infected PBMC
GSE68766	Concurrent progress of reprogramming and gene-correction to overcome limitation of gene therapy of ALK2 mutant iPSCs
GSE69026	Human Calu-3 cell transcriptome response to a wild type infectious clone of H7N9 Influenza virus and mutant H7N9 viruses
GSE69150	Regulation of gene expression by miR-101 in U2OS cells
GSE69210	Modular Transcriptional Repertoire and microRNA-target Analyses in Thymic Tissue of Down Syndrome Infants
GSE69768	Storage time does not modify the gene expression profile of cryopreserved human metaphase II oocytes
GSE69942	IHH mRNA response to genetically-reconstructed Zaire Ebola viruses [mRNA]
GSE70152	Differentiating human embryonic stem cells into corneal epithelial-like cells
GSE70217	Human Calu-3 cell transcriptome response to human interferon α [mRNA]
GSE71253	Human monocyte-derived macrophages polarized by GM-CSF (M1) or M-CSF (M2) in the presence or absence of 50 nanomolar Methotrexate
GSE71283	Comparative gene profiling study: Pak1 deficient human breast cancer cells vs Pak1 wt breast cancer cells
GSE71293	Transcriptional profile of human white adipocytes (hMADS cells) after white-to-brown conversion
GSE71535	The gene expression profile of non-cultured, highly purified human adipose tissue pericytes: transcriptomic evidence that pericytes are stem cells in human adipose tissue
GSE71732	Immortalized human hepatocyte (IHH) mRNA response to interferon alpha treatment
GSE72206	Comparative Gene Profiling Study Between Pak1 Deficient Mouse and Human Breast Cancer Cells
GSE72485	Human pulmonary microvascular endothelial cells (HPMECs): Control siRNA vs HSP27 siRNA
GSE72913	Gene expression signature of MYB-GATA overexpression plus GATA1 down regulation in undifferentiated or differentiated UT7 cells
GSE72926	Human KASUMI-1 cells: Control vs Radotinib (RD) 5uM
GSE72999	Gene expression analysis of sickle cell disease patients
GSE73167	Alectinib-resistant NSCLC harboring EML4-ALK cells: Parental vs. Alectinib-resistant
GSE73196	Gene expression signatures in cell cycle sorted cells [HeLa_mRNA_array]
GSE73198	Gene expression signatures in cell cycle sorted cells [HDFa_mRNA_array]
GSE73256	Gene expression signatures in cell cycle sorted cells [H295R_mRNA_array]
GSE73259	Fluorescence activated cell sorting followed by small RNA sequencing reveals stable microRNA expression during cell cycle progression
GSE73294	Mdm2 enhances stemness-promoting chromatin modifications through the Polycomb Repressor Complex 2 in a p53-Independent Manner [HCT116 microarray]
GSE73417	Antitumoral actions of 9-cis retinoic acid and mitotane in an adrenocortical xenograft model
GSE73548	Development of gene expression signatures for SOX2 overexpressing human dental pulp stem cells
GSE73602	Mdm2 enhances stemness-promoting chromatin modifications through the Polycomb Repressor Complex 2 in a p53-Independent Manner
GSE73724	Development of gene expression signatures for IGF-1 overexpressing human umbilical cord-derived mesenchymal stem cells
GSE74089	Gene expression profiling of hip cartilage with necrosis of femoral head
GSE74144	Gene expression changes in white blood cells of hypertensive patients with left ventricular remodeling
GSE74223	Human DLD1 Cells: shRNA_Control vs. shRNA_FOXQ1
GSE74567	Astrocytoma cell lines transduced to either express GFAP isoforms or to knockdown GFAP isoforms
GSE74610	Natural circular RNA encodes regulatory small peptides in Mammalian cells
GSE74706	Transcriptome of human NSCLC tissues
GSE74708	Effects of a Closed Space Environment on Gene Expression in Hair Follicles of Astronauts in the International Space Station
GSE75051	Donor dependent variations in hematopoietic differentiation among embryonic and induced pluripotent stem cell lines.
GSE75328	Changes in gene expression in primary human white preadipocytes in response to knockdown of DPP4
GSE75380	HUVEC gene profile after Sox7/Sox17 siRNA silencing
GSE75423	mRNA expression profiles in decidualized and non-decidualized endometriotic cyst stromal cells (ECSCs).
GSE75427	Expression profiles in decidualized and non-decidualized endometriotic cyst stromal cells (ECSCs) and normal endometrial stromal cells (NESCs)
GSE75551	Gene expression profile of two colorectal cancer HT29 and DLD-1 cell lines cultivated in 2-dimensional or 3-dimensional cell culture enriched with laminin rich extracellular matrix proteins
GSE75905	Microarray of SIRT6 KO in hepatocellular carcinoma
GSE75915	Gene expression profile of two colorectal cancer HT29 and DLD-1 cell lines treated with single or fractionated ionizing radiation doses under 3D cell culture conditions.
GSE75940	LncVSM (AK098656) up/down-regulation in Vascular Smooth Muscle cells
GSE76135	Oncogenic roles of SETDB2 histone methyltransferase in gastric cancer
GSE76177	Downregulation of WDR20 due to loss of 14q is involved in the malignant transformation of clear cell renal cell carcinoma (WDR20 overexpression in RCC cell line)
GSE76280	Differentially expressed genes between the miR-506-overexpressing AsPC-1 pancreatic cancer cell line (n=3) and its negative control (n=3)
GSE76599	Human Calu-3 cell transcriptome response to a wild type infectious clone of H5N1 Influenza virus and mutant H5N1 viruses [mRNA]
GSE76720	LncVSM (AK098656) down-regulation in Vascular Smooth Muscle cells
GSE76898	Winter bear serum promotes muscle cell growth, increases protein content, and triggers metabolic switch and hibernation-like signatures in human myotubes
GSE77814	Interferon-g and Tumor Necrosis Factor-a Polarize Bone Marrow Stromal Cells Uniformly to a Th1 Phenotype
GSE78179	Gene set enrichment analysis and ingenuity pathway analysis of metastatic clear cell renal cell carcinoma cell line
GSE78245	The retinoblastoma protein regulates hypoxia-inducible genetic programs, tumor cell invasiveness and neuroendocrine differentiation in prostate cancer cells
GSE78944	Screening of differentially expressed genes after IMB5046 treatment
GSE79172	Primary human dendritic cell transcriptome response to a wild type MERS-CoV (icMERS)
GSE79218	Primary human microvascular endothelial cell transcriptome (mRNA) response to a wild type MERS-CoV (icMERS-CoV EMC2012)
GSE79458	Primary human fibroblast transcriptome (mRNA) response to wild type MERS-CoV (icMERS)
GSE79568	HeLa cells: control vs IFN-gamma-treated
GSE80058	Human liver Huh cell transcriptome (mRNA) response to a Wild-type ΔVP30 Ebola virus, Δmucin, and ssGP mutants
GSE80697	Human Calu-3 cell transcriptome response to wild-type pandemic H1N1 (A/California/04/2009), natural isolate [mRNA]
GSE80832	Human U937 cell transcriptome response to Zaire Ebola virus wild-type in the ΔVP30 background and Δmucin virus [mRNA]
GSE81613	Toxoplasma gondii TgIST co-opts host chromatin repressors dampening STAT1-dependent gene regulation and IFN-γ-mediated host defenses.
GSE81629	Gene expression profile changes after ANLN knockdown in J82 cells
GSE81909	Primary human airway epithelial cell transcriptome response to wild type MERS-CoV (icMERS) [mRNA]
GSE83335	Human intestinal epithelial cells: Control vs. MIC-1 Transfected
GSE84126	Mutational landscape of ocular marginal zone lymphoma identified frequent alterations of TNFAIP3 followed by TBL1XR1 and CREBBP mutation
GSE84546	Comparative gene expression profiling of primary and metastatic renal cell carcinoma stem cell-like cancer cells
GSE84616	Mutations in MAFB that cause Multicentric Carpo Tarsal Osteolysis (MCTO) affect the transcriptome of M-MØ
GSE84617	MAFB controls the acquisition of the anti-inflammatory transcriptional profile of M-MØ.
GSE84622	MAFB controls the transcriptional profile of human anti-inflammatory macrophages
GSE84898	Thorax irradiation of Non-Human Primates induces persistent gene expression changes in blood cells.
GSE85141	Gene expression profile perturbed by ATRA
GSE85346	Gene Expression Analysis in Different Macrophage Phenotypes
GSE85536	Candidate ERalpha targets for DNA methylation-mediated gene silencing
GSE85696	Expression signature in a human colorectal cancer cell lines, HCT116 and RKO, transfected with miR-101
GSE85735	miR-449 regulated mitotic genes
GSE85795	Comparison between CBP80-associated and eIF4E-associated mRNAs in actively translating poylsomes
GSE85895	Human bone marrow-derived mesenchymal stem cells (Human BM-MSCs): Control (recombinant human LIGHT, rhLIGHT 0 ng/ml) vs rhLIGHT 200 ng/ml
GSE86528	Primary human fibroblasts transcriptome response to wild type Mers-CoV (icMERS-CoV EMC2012), MFB002
GSE86529	Primary human fibroblasts transcriptome response to wild type MERS-CoV (icMERS-CoV EMC2012), MMVE002
GSE86530	Primary human microvascular endothelial cell transcriptome response to wild type Mers-CoV (icMERS-CoV EMC2012), MHAE002
GSE86539	Human liver Huh cell transcriptome response to a Wild-type ΔVP30 Ebola virus, EHUH003 [mRNA]
GSE86924	Effect of NR4A3 siRNA treatment on gene expression of islet derived hybrid cell of 1.1B4
GSE87211	Colorectal cancer susceptibility loci as predictive markers of rectal cancer prognosis after surgery
GSE87739	Time series messenger RNA analysis of immature T-cells and reMAIT cells by microarrays
GSE88705	Reduction of the tumorigenic potential of human retinoblastoma cell lines by TFF1 overexpression involves p53/caspase signaling and miR-18a regulation
GSE88938	Time series transcriptome and DNA methylome analysis of immature T-cells and reMAIT cells
GSE89501	Gene expression analysis of different subtypes of GSCs upon miR-128 overexpression or downregulation and after knockdown of Polycomb components BMI1 and SUZ12
GSE89985	Difference of gene expression after knockdown CRNDE expression.
GSE90501	Overexpression of CUL4B promotes gastric cancer metastasis through upregulation of HER2
GSE90503	mRNA and miRNA expression profiling of CUL4B knockdown in MKN45 cells
GSE90832	HCT116 (CRC): control siRNA vs. ZNF746 siRNA Transfected
GSE90879	Initial Gene Epxression Responses to Bleomycin Treatment
GSE90909	Gene expression response in human peripheral blood exposed to x-rays or neutrons ex vivo
GSE91077	Global transcriptional profiling confirmed failed decidualization of human Endometrial Stromal Cells (hESCs) obtained from non-pregnant women with a previous pregnancy complicated by severe preeclampsia (sPE).
GSE92251	Gene expression alterations upon knock down of transcription factors
GSE92258	Gene expression profile in tumor tissue in murine human lung cancer model between p-T-miR-7 and p-Cont injection group
GSE92533	Human Oral cancer cells KB: Control vs. CD133 Overexpression
GSE92627	Effect of GAGE12I and SPIN4 on the gene expression profile of BGC823 gastric cancer cells
GSE93135	Gene expression profiling of cancer cells with genetic disruption of DNA methyltransferases [Agilent-026652]
GSE93136	Cancer cells with genetic disruption of DNA methyltransferases
GSE93228	Cell lines iPSC CRL1831 (induced pluripotent stem cells) and CSC DLD1 (cancer stem-like cells) derived from normal colon CRL1831 and colorectal cancer DLD-1 cells in 3D cell culture conditions and subjected to ionizing radiation doses
GSE93525	Xenophagic process controls the Enteroinvasive Escherichia coli infection of the epithelial cells I
GSE93587	Xenophagic process controls the Enteroinvasive Escherichia coli infection of the epithelial cells II
GSE93588	Xenophagic process controls the Enteroinvasive Escherichia coli infection of the epithelial cells III
GSE93639	Protection of SH-SY5Y cells against 6-OHDA by 3,4-dihydroxybenzalacetone (DBL) and caffeic acid phenethyl ester (CAPE)
GSE94608	Serotonin promotes the acquisition of an anti-inflammatory and pro-fibrotic profile in human macrophages via engagement of HTR7
GSE94644	Defective Decidualization During and After Severe Preeclampsia
GSE94714	PMP22 Regulates Self-Renewal and Chemoresistance of Gastric Cancer Cells
GSE95004	Scalable generation of Schwann cell precursors from human pluripotent stem cells
GSE95026	Validation of systems biology derived molecular markers of donor organ status associated with long term allograft function
GSE95563	Whole Human Genome Oligo Microarray
GSE96636	Transcriptome profiling of FK866 response in CCRF-CEM parental and resistant cells
GSE97511	YBX2 and cancer testis antigen 45 contribute to stemness, chemoresistance and a high degree of malignancy in human endometrial cancer
GSE97543	Wnt/β-catenin signaling mediates resistance of colorectal cancer cells to chemoradiotherapy
GSE97558	Genome-wide analysis of the toxic effect of Bortezomib on human esophageal carcinoma epithelial cells
GSE97854	The whole human genome expression data from Huh7 cells
GSE97856	Whole genome and miRNA expression profiling in Huh7 cells
GSE97951	Mechanism of Kindlin-2 regulating invasion and metastasis of human Hepatocellular carcinoma
GSE98603	Characterization of subcutaneous white adipose tissue gene expression profile in control and chronic kidney disease patients
GSE99056	MAPKs control the expression of a novel gene set that defines de activation of human anti-inflammatory macrophages
GSE100191	Transcriptional Signature Associated with Early Rheumatoid Arthritis and Healthy Individuals at high risk to develop the disease.
GSE100424	Expression data in U2OS cells transfected with control-, DBP5-, GLE1- or IPPK-siRNA
GSE100496	Primary human fibroblasts transcriptome response to a wild type Mers-CoV (icMERS-CoV), MFB003
GSE100504	Primary human airway epithelial cell transcriptome response to a wild type Mers-CoV (icMERS-CoV EMC2012), MHAE003
GSE100509	Primary human microvascular endothelial cell transcriptome response to wild type MERS-CoV (icMERS-CoV EMC2012), MMVE003
GSE100705	Trichostatin A preferentially reverses the upregulation of gene expression levels induced by gain of chromosome 7 in colorectal cancer cell lines
GSE100854	Effect of TGFB on primary human alveolar cells type 2 (hAEC2)
GSE102887	Hair follicles engage in chemosensation: Olfactory receptor OR2AT4 regulates human hair growth
GSE103179	Gene expression profile of colorectal cancer HCT116_p53minus cells treated with single (2Gy) or fractionated (5 x 2Gy) doses of ionizing radiation.
GSE103455	mRNA expression profiling in human brain glioblastoma cell line U251 after stable knockdown the expression of linc01116
GSE103519	SIRT1 expression effect on migration and invasion of gastric cancer cells
GSE103569	Comparative analysis of skin- and gut-homing CD8+ T cells in aHSCT patients developing acute graft versus host disease (aGvHD)
GSE103605	Effects of 14 days of confinement on blood gene expression profiles in men
GSE103854	Inositol Trisphosphate Receptor Mediated Ca2+ Signalling Stimulates Mitochondrial Function and Gene Expression in Core Myopathy Patients [Human arrays]
GSE103855	Inositol Trisphosphate Receptor Mediated Ca2+ Signalling Stimulates Mitochondrial Function and Gene Expression in Core Myopathy Patients
GSE103988	Expression of genes in hepatic progenitor-like cells derived from human iPS cells, and cultured progenitor cells
GSE103991	Knockdown of NUP62 of human head and neck squamous cell carcinoma cell line UMSCC1
GSE104008	Characterization of the Filovirus-Resistant Cell Line SH-SY5Y Reveals Redundant Role of Cell Surface Entry Factors
GSE104070	Cancer/testis Antigen-Plac1 Promotes Invasion and Metastasis of Breast Cancer
GSE104244	Bone Marrow Derived Macrophages, NSCLC cell lines, and Kras G12D Lung Tumors Treated with Epigenetic Agents
GSE104488	Dynamic Gene Network Analysis of Caco-2 Cell Response to Shiga Toxin-Producing Escherichia coli-Associated Hemolytic–Uremic Syndrome
GSE104489	Dynamic Gene Network Analysis of Caco-2 Cell Response to Shiga Toxin-Producing Escherichia coli-Associated Hemolytic–Uremic Syndrome
GSE104492	Dynamic gene network analysis of Caco-2 cell response to Shiga toxin-producing Escherichia coli-associated hemolytic-uremic syndrome
GSE104960	Competitive RNA Pair Controls Gastric Cancer Metastasis by Regulating EphrinA1 mRNA Translation
GSE106156	Canagliflozin impact on human renal proximal tubular cells (HK2)
GSE106222	Presence of aggregates of smooth endoplasmic reticulum in MII oocytes affects oocyte development competence: a molecular-based evidence
GSE106465	Massive and reproducible production of liver buds entirely from human pluripotent stem cells
GSE106522	HUH VP30 cells with and without interferon α and β treatment
GSE106523	Primary human lung fibroblast cells transcriptome response to interferon αβ or interferon γ
GSE106524	Primary human lung microvascular endothelial cells treated with universal interferon alpha beta or interferon gamma
GSE106986	Identification of target genes in human lung tissue of COPD patients
GSE107089	Expression data of mRNA from wild-type A549 cells and microRNA-203 knockout A549 cells during H5N1 infections
GSE108000	Gene expression profiling of multiple sclerosis pathology identifies early patterns of demyelination surrounding chronic active lesions
GSE108006	Gene expression-based, identification of differential expression genes in MCF-7 cells with or without silencing of OR2T6 gene
GSE108225	Adenoviral Vector Transduction of Dendritic Cells is Inhibited by Plasma from Cancer Patients
GSE108754	Differentially expressed genes in blood of BPD and Normal preterm neonates [mRNA]
GSE108756	Differentially expressed genes in blood of BPD and Normal preterm neonates
GSE108937	Human iPSC derived posterior gut progenitors are expandable and capable of forming gut and liver organoids
GSE108947	Expression data from human colorectal cancer cell line LoVo
GSE109271	Competitive RNA Pair Controls Gastric Cancer Metastasis by Regulating EphrinA1 Translation
GSE109592	The investigation of target gene of antisense oligonucleotides (ASOs) against microRNA-21 in colorectal carcinoma cells in vivo
GSE110242	Early cell death induced by Clostridium difficile TcdB
GSE110884	The SCN9A channel and plasma membrane depolarization promote cellular senescence through Rb pathway
GSE111542	Expression data of RPTEC cells treated with/without HGF, aMD5-PEG11 and aMD5-BMH
GSE111601	Correlated metabolomic, genomic, and histologic phenotypes in histologically normal breast tissue
GSE111761	Differential expression of IBD susceptibility and IL23R associated pathway genes during ongoing anti-TNF therapy (anti-TNF non-responder vs anti-TNF responder)
GSE113110	Leukemia inhibitory factor via the toll-like receptor 5 signaling pathway involves aggravation of cachexia induced by human gastric cancer-derived 85As2 cells in rats
GSE113534	Minipuberty and Thymic Sexual Dimorphism in the Infant Human Thymus [minipuberty]
GSE113535	Minipuberty and Thymic Sexual Dimorphism in the Infant Human Thymus [non-puberty]
GSE113597	Minipuberty and Sexual Dimorphism in the Infant Human Thymus
GSE113611	Gene expression response in human peripheral blood exposed to mixed neutron-photon radiation ex vivo
GSE113618	The Toxoplasma effector TEEGR promotes parasite persistence by modulating NF-κB signalling via EZH2
GSE113658	The Toxoplasma effector TEEGR promotes parasite persistence by modulating NF-κB signalling via EZH2
GSE113739	mRNA expression of HUVEC cells treated by exosomes derived from colorectal cancer cell line HCT116 transfected with lncRNA-APC1 silenced or control vector
GSE114206	Expression analysis of platinum sensitive and resistant epithelial ovarian cancer patient samples.
GSE114288	PP2A inhibitors arrest G2/M transition through JNK/Sp1-dependent down-regulation of CDK1 and autophagy-dependent up-regulation of p21
GSE114979	The effect of colorectal cancer (CRC) organoid-derived extracellular vesicles on the expression profile of fibroblasts
GSE115002	Gene expression profile of EGFRwt/KRASwt/ALKwt lung adenocarcinoma (“pan-driver-gene-negative” LUAD) and developing a prognostic signature for “pan-driver-gene-negative” LUAD
GSE115116	Gene expression profile in tongue squamous carcinoma cells with stably transduced with LINC01011 shRNA under cisplatin treatment
GSE115855	Genes expression of SU-DHL-2 cells treated with IL-17A
GSE116562	Expression data from human ovarian cancer cell line
GSE116616	Expression data of whole genome from new diagnostic AML patients (with or without EMI) and healthy volunteers
GSE116618	Expression data of whole genome and circRNA from new diagnostic AML patients (with or without EMI) and healthy volunteers
GSE116738	In vitro maturation of human pluripotent stem cell-derived intestinal organoids
GSE118337	Protective effects of SGLT2 inhibitors in human proximal tubular cells
GSE119342	The mRNA profiles of the macrophages with or without Trastuzumab-dependent tumor phagocytosis
GSE119891	K120R mutation inactivates p53 by creating an aberrant splice site leading to nonsense-mediated mRNA decay
GSE121367	Endometrial cancer cell line with acquired resistance to medroxyprogesterone acetate
GSE122749	Gene expression by BTF3 knocked down in Vcap cells
GSE122884	The genes differentially expressed in human colon cancer cells LoVo stably transfected with LV-control and LV-miR-500a respectively.
GSE123521	Screening of differentially expressed genes after DBDx treatment
GSE124112	Analysis of three kinds of tumors gene expression by RNA microarray
GSE124124	Distinct peripheral blood mononuclear cells transcriptional modules in the response to human respiratory syncytial virus or human rhinovirus in hospitalized infants with bronchiolitis
GSE124552	Gene expression profile of human cancer associated hepatic stellate cells in HBV related hepatocellular carcinoma (HCC)
GSE124860	Single Cell Sequencing Reveals Gene Expression Signatures Associated with Bone Marrow Stromal Cell Subpopulations and Time in Culture [microarray]
GSE124862	Single Cell Sequencing Reveals Gene Expression Signatures Associated with Bone Marrow Stromal Cell Subpopulations and Time in Culture
GSE126137	Global transcriptome profiling was performed for keratinocytes transfected with either miR-146a mimics (Pre-146a) or negative control (Pre-NC).
GSE126802	Transcriptome analysis of normal-appearing white matter reveals cortisol- and disease-associated gene expression profiles in multiple sclerosis
GSE128853	Disease-specific alteration of karyopherin-alpha 4 subtype establishes feed-forward oncogenic signaling in squamous cell carcinoma
GSE128887	GALNT10 knockdown in A549 cell line and over-expressing in the H322 cell line
GSE129448	Functional loss of ATRX and telomerase activates Alternative Lengthening of Telomeres (ALT)
GSE129739	Gene expression-based, whole genome-wide expression profile differences for CUL4B-depleted LNCaP cells compared with control
GSE130981	Gene expression signatures in human prostate cancer cells PC3 with lncAPP overexpression and knockdown
GSE131107	Compared the gene expression profiles between the PTL-Her2-CAR-T cells and Her2-CAR-T cells isolated from tumor tissues
GSE131191	Age-related transcriptional modules and TF-miRNA-mRNA interactions in neonatal and infant human thymus [mRNA]
GSE131242	Age-related transcriptional modules and TF-miRNA-mRNA interactions in neonatal and infant human thymus
GSE131761	Gene expression patterns in septic and non-septic shock postsurgical patients
GSE131762	c-Myc drives nab-paclitaxel resistance in pancreatic cancer
GSE132561	In vitro maturation of intestinal organoids differentiated from wild type and STAT3 knock out human embryonic stem cells
GSE132897	Mortality risk score in postsurgical patients based on gene expression
GSE134436	Characterization of IL-1α–responsive enhancers and of IL-1α -mediated changes in chromatin topology.
GSE134481	Effects of Streptococcus oralis biofilm on peri-implant soft-tissue cells
GSE135079	Unified Feature Association Networks through Integration of Transcriptomic and Proteomic Data
GSE135379	Development of gene expression signatures of B7-H3 CAR-T cells for treatment of SAHA
GSE135380	Development of gene expression signatures of CAL-27 cells for treatment of shXBP-1s.
GSE135976	MET regulates expression of co-stimulatory and co-inhibitory molecules in tumor cells and contributes to suppression of immune cell function
GSE136043	mRNAs microarray from 5 fresh lung cancer tissues and 5 fresh non-tumor tissues.
GSE136932	Effect of Pirfenidone on NSCLC [A549/H1975 0.75 mg/ml Pirf]
GSE136933	Effect of Pirfenidone on NSCLC [A549 1.5 mg/ml Pirf 6hrs]
GSE136934	Effect of Pirfenidone on NSCLC [A549 1.5 mg/ml Pirf 24hrs]
GSE136935	Effect of Pirfenidone on NSCLC
GSE137589	The global IL-1α gene expression response in p65 enhancer mutant HeLa cells.
GSE137689	MicroRNA-18a promotes cancer progression through SMG1 suppression and mTOR pathway activation in nasopharyngeal carcinoma
GSE138126	Gene expression signatures for Ibrutinib resistance in Diffuse Large B-cell Lymphoma (ABC-DLBCL)
GSE138127	Gene expression signatures for FGFR1 Knockdown in Mantle cell lymphoma cell line (Z-138)
GSE138282	Expression analysis after EZH1,2 inhibition in lymohoma cells
GSE138650	Novel autophagy inhibitor Lys05 enhances impact of ionizing radiation on human lung cancer cells H1299
GSE138679	Influences of CDK9 on gene expressions
GSE140616	mRNA expression of colorectal cancer cell line HCT116 transfected with lncRNA-SPRY4-IT1 overexpression or control vector
GSE140797	Gene expression signatures for lung adenocarcinoma
GSE141508	Microarray comparing CMV-specific CD8+ T cells from liver sinusoid and peripheral blood
GSE142281	Gene expression-based, identification of differential expression genes in MDA-MB-231 cells with or without knockout of CCDC25 gene and transfected with NET-DNA
GSE145511	Identification of genes regulated by DUSP4
GSE145693	Mitochondrial dysfunction and DNA damage accompany enhanced levels of formaldehyde in cultured primary human fibroblasts
GSE146440	Development of gene expression signatures for glioblastoma with circ2082 knock-down (KD)
GSE146984	KIF15 confers resistance to enzalutamide in castration resistant prostate cancer [array]
GSE147689	Tuberculosis biomarker validation cohort
GSE147690	Tuberculosis biomarker identification cohort
GSE147691	Romanian MDR tuberculosis cohort
GSE148004	Analysis of sputum gene expression data in Asthma and COPD
GSE148540	Culturing of Daoy cells in astrocyte conditioned media
GSE149111	Development of gene expression signatures in the liver cancer cells with FXR overexpression and FXR activation
GSE149557	Albumin-mediated Delivery of Therapeutic Peptides for Pancreatic Cancer Therapy
GSE150082	Pre-existing tumoral B cell infiltration and impaired genome maintenance correlate with response to chemoradiotherapy in locally advanced rectal cancer (LARC)
GSE150298	Gene expression profiling of TNBC and OVCA cell lines in response to Azacitidine and Talazoparib
GSE150896	KIF15 promotes AR and AR-V7 protein stabilization in contribution to enzalutamide resistance of prostate cancers
GSE151650	Role of non-classical progesterone receptors in decidualization process
GSE152950	MicroRNA-342-3p is a regulator of hepatocellular carcinoma regression
GSE153054	Development of gene expression during astrocyte differentiation from human embryonic stem cells
GSE153123	Treatment of Retinoblastoma 1-Intact Hepatocellular Carcinoma With Cyclin-Dependent Kinase 4/6 Inhibitor Combination Therapy
GSE154552	Increased Apoptosis and aberrant apoptosis signaling pathways of CD4+CD25+FOXP3+ regulatory T cells in patients with systemic lupus erythematosus
GSE155168	Gene expression by BTF3 knocked down in MDA-MB-231 cells
GSE155247	Development of gene expression signatures for glioblastoma stem-like cells infected with oncolytic virus
GSE155476	Comparison of gene expression profile of human blastocyst between young and aging infertility patients
GSE156396	Characterization of simplified brain organoids (simBOs) derived from primitive neural stem cells (pNSCs)
GSE156399	MEK5-mediated gene expression changes in DU145 human prostate cancer cells
GSE156401	MEK5-mediated gene expression changes in PC3 human prostate cancer cells
GSE156727	Primary normal human bronchial epithelial cells (NHBE) cultured at air liquid interface with or without macrophage cells (+/- Mac) derived from primary peripheral blood mononuclear cells
GSE156962	To determine the differentially expressed genes in cancer associated fibroblasts upon ablation of the glutamatergic synapse protein NetrinG1. [Microarray]
GSE156964	To determine the differentially expressed genes in cancer associated fibroblasts upon ablation of the glutamatergic synapse protein NetrinG1.
GSE157392	Direct reprogramming of human fibroblasts to expandable induced dopaminergic neuronal progenitors for Parkinson’s disease therapy [Array]
GSE157394	Direct reprogramming of human fibroblasts to expandable induced dopaminergic neuronal progenitors for Parkinson’s disease therapy
GSE157680	Gene expression differences among Neuropilin1 (NRP1) knockdown cell lines
GSE158766	The CD90+CD39+ and CD90+CD39- fibroblast subtypes in human hypertrophic scar and normal skin
GSE158850	Skeletal muscle adaptations to an 8-week weight loss intervention in younger and older obese men
GSE158929	Effect of Cryopreservation on Autologous Chimeric Antigen Receptor T Cell Characteristics
GSE159809	Adipose tissue adaptations to an 8-week weight loss intervention in younger and older obese men,
GSE161007	Whole genome expression microarray of cancer stem cells isolated from HT29 and HCT116 Human colorectal cancer cell lines
GSE162553	MCF10 series 3D cultures: gene expression in association with epithelial p53 status and stromal milieu
GSE169295	Super-enhancer trapping by the nuclear pore via intrinsically disordered regions of proteins in squamous cell carcinoma cells
GSE176162	The study of the effects of dauricine(dau) on human pancreatic carcinoma cells [mRNA array]
GSE176164	The study of the effects of dauricine(dau) on human pancreatic carcinoma cells
GSE178557	Microarray identifies differentially expressed mRNAs of cartilages between osteoarthritis (OA) patients and control patients
GSE180148	MiR-19a/miR-96-mediated low expression of KIF26A suppresses metastasis by regulating FAK pathway in gastric cancer
GSE181549	Large-scale analysis of longitudinal skin gene expression in systemic sclerosis reveals relationships of immune cell and fibroblast activity with skin thickness and a trend towards normalization over time
GSE181716	A Gene expression profiling study of ossification of ligamentun flavum
GSE186142	Enhanced phosphorylation of c-Jun by cisplatin treatment as a potential predictive biomarker for cisplatin response in combination with patient-derived tumor organoids.
GSE186380	Gene expression by CREB5 overexpression in LNCaP cells
GSE186495	Gene expression by Aspergillus protease
GSE193022	Blood leukocyte transcriptional modules and differentially expressed genes associated with disease severity and age in COVID-19 patients
GSE193576	Human gene expression microarray analysis in CEM cells overexpressing HTLV-1 Rex
GSE197405	Activating STING1-dependent immune signaling in TP53 mutant and wild-type acute myeloid leukemia
GSE210189	HUVEC cell transcriptome response to Zaire Ebola virus (EBOV) and mutant lacking the mucin domain (deltamucin-EBOV)
GSE216303	KLF4-PFKFB3-driven glycolysis is essential for phenotypic switching of vascular smooth muscle cells (mRNA microarray)
GSE216306	KLF4-PFKFB3-driven glycolysis is essential for phenotypic switching of vascular smooth muscle cells
GSE216888	Nuclear transport surveillance of p53 by nuclear pores in glioblastoma
GSE222838	Whole human genome expression microarray for circSTK3-related genes
GSE225763	Identification of genes regulated by VSNL1 in colorectal cancer cells
GSE227114	Targeting cis-regulatory elements of FOXO family is a novel therapeutic strategy for induction of leukemia cell differentiation
GSE228517	ASH2L, a COMPASS core subunit, is involved in the cell invasion and migration of triple-negative breast cancer cells through the epigenetic control of histone H3 lysine 4 methylation.
GSE229301	Rawdata of mRNAs microarray from 3 fresh lung cancer tissues and 3 fresh non-tumor tissues.
GSE233437	EZH1/2 dual inhibitors suppress HTLV-1-infected cell proliferation and hyperimmune response in HTLV-1-associated myelopathy
GSE243320	RSK3 switches cell fate: from stress-induced senescence to malignant progression
GSE245843	Expression analysis of SHOT-RNA KD in LNCaP
GSE252801	Gene expression profiling of human fibroblast MRC5 cells exposed to cigarette smoke condensate (CSC)

Relations

Alternative to

GPL10332

Data table header descriptions
ID	Agilent feature number
SPOT_ID	Spot identifier
CONTROL_TYPE	Control type
REFSEQ	RefSeq Accession number
GB_ACC	GenBank Accession number
GENE	Entrez Gene ID
GENE_SYMBOL	Gene Symbol
GENE_NAME	Gene Name
UNIGENE_ID	UnigeneID
ENSEMBL_ID	EnsemblID
TIGR_ID	TIGRID
ACCESSION_STRING	Accession String
CHROMOSOMAL_LOCATION	Chromosomal Location
CYTOBAND	Cytoband
DESCRIPTION	Description
GO_ID	GoIDs
SEQUENCE	Sequence

Data table

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

GENE

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

TIGR_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

(+)E1A_r60_1

pos

(+)E1A_r60_3

pos

(+)E1A_r60_a104

pos

(+)E1A_r60_a107

pos

(+)E1A_r60_a135

pos

(+)E1A_r60_a20

pos

(+)E1A_r60_a22

pos

(+)E1A_r60_a97

pos

(+)E1A_r60_n11

pos

(+)E1A_r60_n9

pos

(-)3xSLv1

neg

A_23_P100001

FALSE

NM_207446

400451

FAM174B

family with sequence similarity 174, member B

Hs.27373

ENST00000557398

ref|NM_207446|ens|ENST00000557398|ens|ENST00000553393|ens|ENST00000327355

chr15:93160848-93160789

hs|15q26.1

Homo sapiens family with sequence similarity 174, member B (FAM174B), mRNA [NM_207446]

GO:0016020(membrane)|GO:0016021(integral to membrane)

ATCTCATGGAAAAGCTGGATTCCTCTGCCTTACGCAGAAACACCCGGGCTCCATCTGCCA

A_23_P100022

FALSE

NM_014848

9899

SV2B

synaptic vesicle glycoprotein 2B

Hs.21754

ENST00000557410

ref|NM_014848|ref|NM_001167580|ens|ENST00000557410|ens|ENST00000330276

chr15:91838329-91838388

hs|15q26.1

Homo sapiens synaptic vesicle glycoprotein 2B (SV2B), transcript variant 1, mRNA [NM_014848]

ATGTCGGCTGTGGAGGGTTAAAGGGATGAGGCTTTCCTTTGTTTAGCAAATCTGTTCACA

A_23_P100056

FALSE

NM_194272

348093

RBPMS2

RNA binding protein with multiple splicing 2

Hs.436518

ENST00000300069

ref|NM_194272|ens|ENST00000300069|gb|AK127873|gb|AK124123

chr15:65032375-65032316

hs|15q22.31

Homo sapiens RNA binding protein with multiple splicing 2 (RBPMS2), mRNA [NM_194272]

GO:0000166(nucleotide binding)|GO:0003676(nucleic acid binding)

CCCTGTCAGATAAGTTTAATGTTTAGTTTGAGGCATGAAGAAGAAAAGGGTTTCCATTCT

A_23_P100074

FALSE

NM_020371

57099

AVEN

apoptosis, caspase activation inhibitor

Hs.555966

ENST00000306730

ref|NM_020371|ens|ENST00000306730|gb|AF283508|gb|BC010488

chr15:34158739-34158680

hs|15q14

Homo sapiens apoptosis, caspase activation inhibitor (AVEN), mRNA [NM_020371]

GACCAGCCAGTTTACAAGCATGTCTCAAGCTAGTGTGTTCCATTATGCTCACAGCAGTAA

A_23_P100127

FALSE

NM_170589

57082

CASC5

cancer susceptibility candidate 5

Hs.181855

ENST00000260369

ref|NM_170589|ref|NM_144508|ens|ENST00000260369|ens|ENST00000533001

chr15:40917525-40917584

hs|15q15.1

Homo sapiens cancer susceptibility candidate 5 (CASC5), transcript variant 1, mRNA [NM_170589]

CGGTCTCTAGCAAAGATTCAGGCATTGGATCTGTTGCAGGTAAACTGAACCTAAGTCCTT

A_23_P100141

FALSE

NM_023076

64718

UNKL

unkempt homolog (Drosophila)-like

Hs.643536

ENST00000397464

ref|NM_023076|ref|NM_001193388|ref|NM_001193389|ens|ENST00000397464

chr16:1415345-1415286

hs|16p13.3

Homo sapiens unkempt homolog (Drosophila)-like (UNKL), transcript variant 3, mRNA [NM_023076]

AGCAGAGGGGATCCAACGTCAGAGCTTTTAGAATTACTTTTTTAAGCAGCTGTCTTCTGG

A_23_P100189

FALSE

NM_002761

5619

PRM1

protamine 1

Hs.2909

ENST00000312511

ref|NM_002761|ens|ENST00000312511|gb|Y00443|gb|AY651260

chr16:11374862-11374803

hs|16p13.13

Homo sapiens protamine 1 (PRM1), mRNA [NM_002761]

GTAGAAGACACTAATTGCACAAAATAGCACATCCACCAAACTCCTGCCTGAGAATGTTAC

A_23_P100196

FALSE

NM_005153

9100

USP10

ubiquitin specific peptidase 10

Hs.136778

ENST00000219473

ref|NM_005153|ens|ENST00000219473|ens|ENST00000397953|ens|ENST00000540269

chr16:84812831-84812890

hs|16q24.1

Homo sapiens ubiquitin specific peptidase 10 (USP10), mRNA [NM_005153]

TTGGGGTTCGTGCACAACACAGCTTCTGTTGACTCTAACTTCCAAATCAAAATCATTTGG

A_23_P100203

FALSE

NM_001537

3281

HSBP1

heat shock factor binding protein 1

Hs.250899

ENST00000433866

ref|NM_001537|ens|ENST00000433866|gb|AK172732|gb|BX537440

chr16:83846244-83846303

hs|16q23.3

Homo sapiens heat shock factor binding protein 1 (HSBP1), mRNA [NM_001537]

GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0003714(transcription corepressor activity)|GO:0005634(nucleus)|GO:0005856(cytoskeleton)|GO:0006936(muscle contraction)

ACAAATTACATGGGGAACATAAAGGAGTGAGATCCTTCTGTGATAAAATGAATTCACCAC

Total number of rows: 34184

Table truncated, full table size 21885 Kbytes.

Download family	Format
SOFT formatted family file(s)	SOFT
MINiML formatted family file(s)	MINiML

Supplementary data files not provided