NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL13497 Query DataSets for GPL13497
Status Public on May 05, 2011
Title Agilent-026652 Whole Human Genome Microarray 4x44K v2 (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description *** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL10332.
 
Submission date May 05, 2011
Last update date Jan 09, 2018
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (7254) GSM636910, GSM636911, GSM636912, GSM636913, GSM720948, GSM720949 
Series (384)
GSE25931 Gene Expression Profiling of Human Embryonic Neural Stem Cells and Dopaminergic Neurons from Adult Human Substantia Nigra
GSE29106 Microarray Profile of Measles Virus Nucleocapsid Protein (MVNP) Regulated Gene Expression in RANKL and M-CSF stimulated normal human bone marrow derived non-adherent cells.
GSE29107 Microarray profile of p62P392L-regulated gene expression in RANKL and M-CSF stimulated normal human bone marrow derived non-adherent cells
Relations
Alternative to GPL10332

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
(+)E1A_r60_1 (+)E1A_r60_1 pos
(+)E1A_r60_3 (+)E1A_r60_3 pos
(+)E1A_r60_a104 (+)E1A_r60_a104 pos
(+)E1A_r60_a107 (+)E1A_r60_a107 pos
(+)E1A_r60_a135 (+)E1A_r60_a135 pos
(+)E1A_r60_a20 (+)E1A_r60_a20 pos
(+)E1A_r60_a22 (+)E1A_r60_a22 pos
(+)E1A_r60_a97 (+)E1A_r60_a97 pos
(+)E1A_r60_n11 (+)E1A_r60_n11 pos
(+)E1A_r60_n9 (+)E1A_r60_n9 pos
(-)3xSLv1 (-)3xSLv1 neg
A_23_P100001 A_23_P100001 FALSE NM_207446 NM_207446 400451 FAM174B family with sequence similarity 174, member B Hs.27373 ENST00000557398 ref|NM_207446|ens|ENST00000557398|ens|ENST00000553393|ens|ENST00000327355 chr15:93160848-93160789 hs|15q26.1 Homo sapiens family with sequence similarity 174, member B (FAM174B), mRNA [NM_207446] GO:0016020(membrane)|GO:0016021(integral to membrane) ATCTCATGGAAAAGCTGGATTCCTCTGCCTTACGCAGAAACACCCGGGCTCCATCTGCCA
A_23_P100022 A_23_P100022 FALSE NM_014848 NM_014848 9899 SV2B synaptic vesicle glycoprotein 2B Hs.21754 ENST00000557410 ref|NM_014848|ref|NM_001167580|ens|ENST00000557410|ens|ENST00000330276 chr15:91838329-91838388 hs|15q26.1 Homo sapiens synaptic vesicle glycoprotein 2B (SV2B), transcript variant 1, mRNA [NM_014848] GO:0001669(acrosomal vesicle)|GO:0006836(neurotransmitter transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0022857(transmembrane transporter activity)|GO:0030054(cell junction)|GO:0030672(synaptic vesicle membrane)|GO:0031410(cytoplasmic vesicle)|GO:0045202(synapse) ATGTCGGCTGTGGAGGGTTAAAGGGATGAGGCTTTCCTTTGTTTAGCAAATCTGTTCACA
A_23_P100056 A_23_P100056 FALSE NM_194272 NM_194272 348093 RBPMS2 RNA binding protein with multiple splicing 2 Hs.436518 ENST00000300069 ref|NM_194272|ens|ENST00000300069|gb|AK127873|gb|AK124123 chr15:65032375-65032316 hs|15q22.31 Homo sapiens RNA binding protein with multiple splicing 2 (RBPMS2), mRNA [NM_194272] GO:0000166(nucleotide binding)|GO:0003676(nucleic acid binding) CCCTGTCAGATAAGTTTAATGTTTAGTTTGAGGCATGAAGAAGAAAAGGGTTTCCATTCT
A_23_P100074 A_23_P100074 FALSE NM_020371 NM_020371 57099 AVEN apoptosis, caspase activation inhibitor Hs.555966 ENST00000306730 ref|NM_020371|ens|ENST00000306730|gb|AF283508|gb|BC010488 chr15:34158739-34158680 hs|15q14 Homo sapiens apoptosis, caspase activation inhibitor (AVEN), mRNA [NM_020371] GO:0005515(protein binding)|GO:0005622(intracellular)|GO:0005624(membrane fraction)|GO:0006915(apoptosis)|GO:0006916(anti-apoptosis)|GO:0012505(endomembrane system)|GO:0016020(membrane) GACCAGCCAGTTTACAAGCATGTCTCAAGCTAGTGTGTTCCATTATGCTCACAGCAGTAA
A_23_P100127 A_23_P100127 FALSE NM_170589 NM_170589 57082 CASC5 cancer susceptibility candidate 5 Hs.181855 ENST00000260369 ref|NM_170589|ref|NM_144508|ens|ENST00000260369|ens|ENST00000533001 chr15:40917525-40917584 hs|15q15.1 Homo sapiens cancer susceptibility candidate 5 (CASC5), transcript variant 1, mRNA [NM_170589] GO:0000087(M phase of mitotic cell cycle)|GO:0000236(mitotic prometaphase)|GO:0000278(mitotic cell cycle)|GO:0000777(condensed chromosome kinetochore)|GO:0001669(acrosomal vesicle)|GO:0001675(acrosome assembly)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005694(chromosome)|GO:0005730(nucleolus)|GO:0005829(cytosol)|GO:0006334(nucleosome assembly)|GO:0007059(chromosome segregation)|GO:0008608(attachment of spindle microtubules to kinetochore)|GO:0010923(negative regulation of phosphatase activity)|GO:0034080(CenH3-containing nucleosome assembly at centromere)|GO:0051301(cell division)|GO:0071173(spindle assembly checkpoint) CGGTCTCTAGCAAAGATTCAGGCATTGGATCTGTTGCAGGTAAACTGAACCTAAGTCCTT
A_23_P100141 A_23_P100141 FALSE NM_023076 NM_023076 64718 UNKL unkempt homolog (Drosophila)-like Hs.643536 ENST00000397464 ref|NM_023076|ref|NM_001193388|ref|NM_001193389|ens|ENST00000397464 chr16:1415345-1415286 hs|16p13.3 Homo sapiens unkempt homolog (Drosophila)-like (UNKL), transcript variant 3, mRNA [NM_023076] GO:0003676(nucleic acid binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0008270(zinc ion binding)|GO:0016874(ligase activity)|GO:0046872(metal ion binding) AGCAGAGGGGATCCAACGTCAGAGCTTTTAGAATTACTTTTTTAAGCAGCTGTCTTCTGG
A_23_P100189 A_23_P100189 FALSE NM_002761 NM_002761 5619 PRM1 protamine 1 Hs.2909 ENST00000312511 ref|NM_002761|ens|ENST00000312511|gb|Y00443|gb|AY651260 chr16:11374862-11374803 hs|16p13.13 Homo sapiens protamine 1 (PRM1), mRNA [NM_002761] GO:0000786(nucleosome)|GO:0003677(DNA binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005694(chromosome)|GO:0006323(DNA packaging)|GO:0006997(nucleus organization)|GO:0007275(multicellular organismal development)|GO:0007283(spermatogenesis)|GO:0007286(spermatid development)|GO:0030154(cell differentiation)|GO:0030261(chromosome condensation) GTAGAAGACACTAATTGCACAAAATAGCACATCCACCAAACTCCTGCCTGAGAATGTTAC
A_23_P100196 A_23_P100196 FALSE NM_005153 NM_005153 9100 USP10 ubiquitin specific peptidase 10 Hs.136778 ENST00000219473 ref|NM_005153|ens|ENST00000219473|ens|ENST00000397953|ens|ENST00000540269 chr16:84812831-84812890 hs|16q24.1 Homo sapiens ubiquitin specific peptidase 10 (USP10), mRNA [NM_005153] GO:0002039(p53 binding)|GO:0004221(ubiquitin thiolesterase activity)|GO:0004843(ubiquitin-specific protease activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005769(early endosome)|GO:0006281(DNA repair)|GO:0006508(proteolysis)|GO:0006511(ubiquitin-dependent protein catabolic process)|GO:0008233(peptidase activity)|GO:0008234(cysteine-type peptidase activity)|GO:0016579(protein deubiquitination)|GO:0030330(DNA damage response, signal transduction by p53 class mediator)|GO:0042980(cystic fibrosis transmembrane conductance regulator binding)|GO:0045111(intermediate filament cytoskeleton) TTGGGGTTCGTGCACAACACAGCTTCTGTTGACTCTAACTTCCAAATCAAAATCATTTGG
A_23_P100203 A_23_P100203 FALSE NM_001537 NM_001537 3281 HSBP1 heat shock factor binding protein 1 Hs.250899 ENST00000433866 ref|NM_001537|ens|ENST00000433866|gb|AK172732|gb|BX537440 chr16:83846244-83846303 hs|16q23.3 Homo sapiens heat shock factor binding protein 1 (HSBP1), mRNA [NM_001537] GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0003714(transcription corepressor activity)|GO:0005634(nucleus)|GO:0005856(cytoskeleton)|GO:0006936(muscle contraction) ACAAATTACATGGGGAACATAAAGGAGTGAGATCCTTCTGTGATAAAATGAATTCACCAC

Total number of rows: 34184

Table truncated, full table size 21885 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap