NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15943 Query DataSets for GPL15943
Status Public on Aug 17, 2012
Title Illumina mouse-6 v1.1 expression beadchip [TargetID centered version]
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Mus musculus
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description Identical to GPL6105, except centered to the TargetID.
The MouseWG-6 v1.1 Expression BeadChip contains six wholegenome gene expression arrays allowing six samples to be hybridized to a single chip. BeadChip content was created by combining proven sources, including the Mouse Exonic Evidence Based Oligonucleotide (MEEBO) set, the RIKEN FANTOM 22-5 database, and the National Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) database.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html
 
Submission date Aug 15, 2012
Last update date Jan 17, 2013
Contact name Mingfang Lu
E-mail(s) lum3@niaid.nih.gov
Phone 3014435755
Organization name NIH/NIAID
Department LCID
Lab Antibacterial Host Defense
Street address 9000 Rockville Pike
City Bethesda
State/province MD
ZIP/Postal code 20892
Country USA
 
Samples (4) GSM986464, GSM986465, GSM986466, GSM986467
Series (1)
GSE40154 Genome-wide anyalysis of gene expression during prolonged endotoxin tolerance in Aoah -/- mice
Relations
Alternative to GPL6105

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
SPECIES
SOURCE Transcript sequence source name
SEARCH_KEY Internal id useful for custom design array
ILMN_GENE Internal gene symbol
ENTREZ_GENE_ID Entrez gene id
SYMBOL Gene symbol from the source database
CHROMOSOME Chromosome
PROBE_CHR_ORIENTATION Orientation on the NCBI genome built
CYTOBAND
DEFINITION Gene description from the source
ONTOLOGY_COMPONENT Cellular component annotations from Gene Ontology project
ONTOLOGY_PROCESS Biological process annotations from Gene Ontology project
ONTOLOGY_FUNCTION Molecular function annotations from Gene Ontology project
SYNONYMS Gene symbol synonyms from Refseq
OBSOLETE_PROBE_ID Identifier of probe id before bgx time
GB_ACC GenBank Accession number
SPOT_ID
SEQUENCE Probe sequence

Data table
ID SPECIES SOURCE SEARCH_KEY ILMN_GENE ENTREZ_GENE_ID SYMBOL CHROMOSOME PROBE_CHR_ORIENTATION CYTOBAND DEFINITION ONTOLOGY_COMPONENT ONTOLOGY_PROCESS ONTOLOGY_FUNCTION SYNONYMS OBSOLETE_PROBE_ID GB_ACC SPOT_ID SEQUENCE
THRSP Mus musculus Riken ri|C730035M01|PX00087M15|AK050300|1404 THRSP Thrsp A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] AK050300 GCCCTGCCTGACCTGGAAACGTAGAGATTCTTCTGCCTCAGGTTCCAGAG
LOC233991 Mus musculus RefSeq XM_146216.2 LOC233991 LOC233991 XM_146216.2 GCTGGTGAGAGAACTGGAGGCCATAAAAGAAGATGGAATCATGGATGCTG
SLC1A1 Mus musculus RefSeq scl020510.12_56 SLC1A1 20510 Slc1a1 19 + 19qC1 Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA. XM_001002173 XM_001002184 XM_001002198 XM_001002207 Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] The directed movement of substances (such as macromolecules, small molecules, ions) into, out of, within or between cells, or within a multicellular organism [goid 6810] [evidence IEA]; The directed movement of dicarboxylic acids into, out of, within or between cells [goid 6835] [evidence IEA] Enables the active transport of a solute across a membrane by a mechanism whereby two or more species are transported together in the same direction in a tightly coupled process not directly linked to a form of energy other than chemiosmotic energy [goid 15293] [evidence IEA]; Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: dicarboxylate(out) + Na+(out) = dicarboxylate(in) + Na+(in) [goid 17153] [evidence IEA]; Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: glutamate(out) + Na+(out) = glutamate(in) + Na+(in) [goid 15501] [evidence IDA] MEAAC1; EAAC2; EAAC1; EAAT3; D130048G10Rik MEAAC1; EAAC2; EAAC1; EAAT3; D130048G10Rik NM_009199.2 CAGGTGGTTCTCCTTAGTGGCAGTGAATTGGCAGAGCCGTTCACAAGATC
CNDP1 Mus musculus RefSeq NM_177450.2 CNDP1 338403 Cndp1 18 - 18qE4 Mus musculus carnosine dipeptidase 1 (metallopeptidase M20 family) (Cndp1), mRNA. That part of the cytoplasm that does not contain membranous or particulate subcellular components [goid 5829] [evidence ISO] The hydrolysis of a peptide bond or bonds within a protein [goid 6508] [evidence ISO] Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the hydrolysis of the terminal or penultimate peptide bond at the C-terminal end of a peptide or polypeptide [goid 4180] [evidence IEA]; Interacting selectively with zinc (Zn) ions [goid 8270] [evidence IEA]; Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid [goid 8233] [evidence IEA]; Interacting selectively with any metal ion [goid 46872] [evidence IEA]; Catalysis of the hydrolysis of peptide bonds by a mechanism in which water acts as a nucleophile, one or two metal ions hold the water molecule in place, and charged amino acid side chains are ligands for the metal ions [goid 8237] [evidence IEA]; The formation of a protein dimer, a macromolecular structure consists of two noncovalently associated identical or nonidentical subunits [goid 46983] [evidence IEA]; Catalysis of the hydrolysis of a dipeptide [goid 16805] [evidence ISO] AI746433; Cn1 AI746433; Cn1 NM_177450.2 GCTCAATGAGTTTATCTGAATTGCTTAAGGCTTTTAACAGCGCCAGCATC
ZFP329 Mus musculus RefSeq scl0067230.1_121 ZFP329 67230 Zfp329 7 - 7qA1 Mus musculus zinc finger protein 329 (Zfp329), mRNA. A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]; The living contents of a cell; the matter contained within (but not including) the plasma membrane, usually taken to exclude large vacuoles and masses of secretory or ingested material. In eukaryotes it includes the nucleus and cytoplasm [goid 5622] [evidence IEA] Any process that modulates the frequency, rate or extent of DNA-dependent transcription [goid 6355] [evidence IEA]; The synthesis of either RNA on a template of DNA or DNA on a template of RNA [goid 6350] [evidence IEA] Interacting selectively with zinc (Zn) ions [goid 8270] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with any metal ion [goid 46872] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA] 2810439M05Rik; ZNF329; 4632409L22Rik 2810439M05Rik; ZNF329; 4632409L22Rik NM_026046.2 CTTGAGTGAACAAAGGATTTGTTTTCAGATGTGACTTCCCTTGCTCGCAG
LOC277902 Mus musculus RefSeq XM_205594.3 LOC277902 LOC277902 XM_205594.3 GTGACGGTGACAGTGGCAGATTCTAACGGGGAGAGGGTGGGCACGGAAAT
6030426L16RIK Mus musculus MEEBO scl0077114.1_105 6030426L16RIK 6030426L16Rik NM_183121.1 GAAAAAATGAAAGGTTTAATCTTCCAATGCCAGTTGCCATGGGCAAGCCA
LOC100048221 Mus musculus RefSeq scl41352.8_186 LOC100048221 100048221 LOC100048221 PREDICTED: Mus musculus similar to Dullard homolog (Xenopus laevis) (LOC100048221), mRNA. NM_026017.2 GGAAATGCCAGACTGGGACAGGCGAAGGCCTAGAGGAGCCGAAACAGTCT
4930537H20RIK Mus musculus MEEBO scl21919.2_525 4930537H20RIK 4930537H20Rik 4930537H20Rik CACAGTGAGGATACAGCTTCCCACCCCACCCTATTGCACTAGCTAAGTCA
MTAP6 Mus musculus Riken ri|C230092K21|PX00177D07|AK082709|4784 MTAP6 Mtap6 All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA]; Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles [goid 5856] [evidence IEA]; Any of the long, generally straight, hollow tubes of internal diameter 12-15 nm and external diameter 24 nm found in a wide variety of eukaryotic cells; each consists (usually) of 13 protofilaments of polymeric tubulin, staggered in such a manner that the tubulin monomers are arranged in a helical pattern on the microtubular surface, and with the alpha/beta axes of the tubulin subunits parallel to the long axis of the tubule; exist in equilibrium with pool of tubulin monomers and can be rapidly assembled or disassembled in response to physiological stimuli; concerned with force generation, e.g. in the spindle [goid 5874] [evidence IEA]; A compound membranous cytoplasmic organelle of eukaryotic cells, consisting of flattened, ribosome-free vesicles arranged in a more or less regular stack. The Golgi apparatus differs from the endoplasmic reticulum in often having slightly thicker membranes, appearing in sections as a characteristic shallow semicircle so that the convex side (cis or entry face) abuts the endoplasmic reticulum, secretory vesicles emerging from the concave side (trans or exit face). In vertebrate cells there is usually one such organelle, while in invertebrates and plants, where they are known usually as dictyosomes, there may be several scattered in the cytoplasm. The Golgi apparatus processes proteins produced on the ribosomes of the rough endoplasmic reticulum; such processing includes modification of the core oligosaccharides of glycoproteins, and the sorting and packaging of proteins for transport to a variety of cellular locations. Three different regions of the Golgi are now recognized both in terms of structure and function: cis, in the vicinity of the cis face, trans, in the vicinity of the trans face, and medial, lying between the cis and trans regions [goid 5794] [evidence IEA] Interacting selectively with calmodulin, a calcium-binding protein with many roles, both in the calcium-bound and calcium-free states [goid 5516] [evidence IEA]; Interacting selectively with microtubules, filaments composed of tubulin monomers [goid 8017] [evidence IDA] AK082709 GCCCGCCCCTCAGATGCGACGACTCACTTCAAATGTTGGTCTGTGCCTTT
ETFA Mus musculus RefSeq NM_145615.2 ETFA 110842 Etfa 9 - 9qB Mus musculus electron transferring flavoprotein, alpha polypeptide (Etfa), nuclear gene encoding mitochondrial protein, mRNA. A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA]; A protein complex located in the mitochondrion. It contains flavin adenine dinucleotide (FAD) that, together with an acyl-CoA dehydrogenase, forms a system that oxidizes an acyl-CoA molecule and reduces ubiquinone and other acceptors in the mitochondrial electron transport system [goid 17133] [evidence TAS] A process whereby a series of electron carriers operate together to transfer electrons from donors to any of several different terminal electron acceptors to generate a transmembrane electrochemical gradient [goid 22900] [evidence IEA]; The directed movement of substances (such as macromolecules, small molecules, ions) into, out of, within or between cells, or within a multicellular organism [goid 6810] [evidence IEA] Interacting selectively with FAD, flavin-adenine dinucleotide, the coenzyme or the prosthetic group of various flavoprotein oxidoreductase enzymes [goid 50660] [evidence IEA]; Any molecular entity that serves as an electron acceptor and electron donor in an electron transport system [goid 9055] [evidence TAS] D9Ertd394e; 2010200I21Rik D9Ertd394e; 2010200I21Rik NM_145615.2 ATGATTCCCTAGCACCCATTACTCTAAATACTATCACTGCAGCTGGACGT
LOC100046918 Mus musculus RefSeq NM_145615.2 LOC100046918 100046918 LOC100046918 PREDICTED: Mus musculus similar to Electron transferring flavoprotein, alpha polypeptide (LOC100046918), mRNA. NM_145615.2 ATGATTCCCTAGCACCCATTACTCTAAATACTATCACTGCAGCTGGACGT
9530095N04RIK Mus musculus Riken ri|9530095N04|PX00654M15|AK079300|940 9530095N04RIK 9530095N04Rik AK079300 GGTTGACCCACAAAGTGGAAGGAGAGAACTGACCTCTGACCTCCGTGTGT
NPR1 Mus musculus RefSeq scl018160.1_34 NPR1 18160 Npr1 3 - 3qF1 Mus musculus natriuretic peptide receptor 1 (Npr1), mRNA. Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA] The chemical reactions and pathways resulting in the formation of cyclic GMP, guanosine 3',5'-phosphate [goid 6182] [evidence IEA]; The process that modulates the force with which blood travels through the circulatory system. The process is controlled by a balance of processes that increase pressure and decrease pressure [goid 8217] [evidence IMP]; The process of introducing a phosphate group on to a protein [goid 6468] [evidence IEA]; A series of reactions within the cell that occur as a result of a single trigger reaction or compound [goid 7242] [evidence IEA]; The chemical reactions and pathways resulting in the formation of a cyclic nucleotide, a nucleotide in which the phosphate group is in diester linkage to two positions on the sugar residue [goid 9190] [evidence IEA] Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring [goid 16829] [evidence IEA]; Combining with an extracellular or intracellular messenger to initiate a change in cell activity [goid 4872] [evidence IEA]; Catalysis of the phosphorylation of an amino acid residue in a protein, usually according to the reaction: a protein + ATP = a phosphoprotein + ADP [goid 4672] [evidence IEA]; Interacting selectively with chloride ions (Cl-) [goid 31404] [evidence IEA]; Catalysis of the reaction: GTP = 3',5'-cyclic GMP + diphosphate [goid 4383] [evidence IDA]; Catalysis of the reaction: GTP = 3',5'-cyclic GMP + diphosphate [goid 4383] [evidence IMP]; Combining with an extracellular or intracellular peptide to initiate a G-protein mediated change in cell activity. A G-protein is a signal transduction molecule that alternates between an inactive GDP-bound and an active GTP-bound state [goid 8528] [evidence IEA]; [goid 16849] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA] NPR-A; Pndr; AI893888; GC-A; MGC117511; NPRA NPR-A; Pndr; AI893888; GC-A; MGC117511; NPRA NM_008727.5 GGGACTGGAGGGGGACTCCTAAGTTTATAGGGCTGACTGAAATACCCAGT
MXI1 Mus musculus RefSeq scl0017859.1_306 MXI1 17859 Mxi1 19 + 19qD2 Mus musculus Max interacting protein 1 (Mxi1), transcript variant 3, mRNA. A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IDA] Any process that modulates the frequency, rate or extent of DNA-dependent transcription [goid 6355] [evidence IEA]; The synthesis of either RNA on a template of DNA or DNA on a template of RNA [goid 6350] [evidence IEA]; Any process that modulates the frequency, rate or extent of the synthesis of either RNA on a template of DNA or DNA on a template of RNA [goid 45449] [evidence IEA]; Any process that stops, prevents or reduces the frequency, rate or extent of transcription from an RNA polymerase II promoter [goid 122] [evidence IDA] Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Plays a role in regulating transcription; may bind a promoter or enhancer DNA sequence or interact with a DNA-binding transcription factor [goid 30528] [evidence IEA]; Any transcription regulator activity that prevents or downregulates transcription [goid 16564] [evidence IDA]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [evidence IPI] Mad2 Mad2 NM_010847.3 TTTCAGTCCTGTAGTTTTATTTTATGTTTAGATAGGGCTGGGCAAGGAAA
5830436K05RIK Mus musculus Riken ri|6720422K01|PX00059I12|AK032734|1961 5830436K05RIK 5830436K05Rik AK032734 GCACACGAGGGTGACAGTGTATGAACAACTGTAGCTGAGCCCATGGCAGA
DTX3L Mus musculus RefSeq scl0209200.1_109 DTX3L 209200 Dtx3l 16 - 16qB3 Mus musculus deltex 3-like (Drosophila) (Dtx3l), mRNA. Interacting selectively with any metal ion [goid 46872] [evidence IEA]; Interacting selectively with zinc (Zn) ions [goid 8270] [evidence IEA] MGC103262; BC023741; AU042200 MGC103262; BC023741; AU042200 NM_001013371.1 CCCTAGGCCAGTGAGTTCCATCCCATAATTCTTTTTCATGTCCATCTCTG
DARS2 Mus musculus RefSeq scl16057.16_35 DARS2 226539 Dars2 1 - 1qH2.1 Mus musculus aspartyl-tRNA synthetase 2 (mitochondrial) (Dars2), nuclear gene encoding mitochondrial protein, mRNA. A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA] The chemical reactions and pathways resulting in the formation of a protein. This is a ribosome-mediated process in which the information in messenger RNA (mRNA) is used to specify the sequence of amino acids in the protein [goid 6412] [evidence IEA]; The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis [goid 6418] [evidence IEA]; The process of coupling aspartate to aspartyl-tRNA, catalyzed by aspartyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA [goid 6422] [evidence IEA] Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of pyrophosphate and AMP [goid 4812] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Catalysis of the ligation of two substances with concomitant breaking of a diphosphate linkage, usually in a nucleoside triphosphate. Ligase is the systematic name for any enzyme of EC class 6 [goid 16874] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Catalysis of the reaction: ATP + L-aspartate + tRNA(Asp) = AMP + diphosphate + L-aspartyl-tRNA(Asp) [goid 4815] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA] MGC99963; 5830468K18Rik MGC99963; 5830468K18Rik NM_172644.2 GACAGACTGGTATGTCTTGTCACGGGAGCACCCAGCATCAGAGATGTCAT
A530058O07RIK Mus musculus MEEBO scl45045.1.1_21 A530058O07RIK A530058O07Rik A530058O07Rik CCCTGCTTTCAGCAGTGCCTACATATTTAACTGAAATATTGGATTTAGGT
9330152L17 Mus musculus MEEBO scl54662.1.1_35 9330152L17 9330152L17 NM_177917.2 CTGCTGCCTTTTATCTGTGAGGTGGTAATGAAATACCAGGAATGGTGTGT

Total number of rows: 34596

Table truncated, full table size 33208 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap