NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL16384 Query DataSets for GPL16384
Status Public on Dec 17, 2012
Title [miRNA-3] Affymetrix Multispecies miRNA-3 Array
Technology type in situ oligonucleotide
Distribution commercial
Organism synthetic construct
Manufacturer Affymetrix
Manufacture protocol See manufacturer's web site
 
Description #%chip_type=miRNA-3_0 or miRNA-3_1
#%create_date=Mon Dec 3, 2012
#
# miRNAs/stem-loops:
# * An annot name generally represents one genome location, but may refer to multiple annotations because of multiple mature products delineated by "-3p" and "-5p", or ".1" and ".2".
# * Also, those with a '-star' are minor products, and those without '-star' or any other aforementioned suffix are considered the major product.
# * Probeset IDs may appear more than once because the miRNA was mapped to multiple locations in the genome, and the annot names may have a "-1", "-2", etc type of suffix.
# * Probeset IDs with a letter suffix (eg, fru-miR-23a and fru-miR-23b) are related miRNAs where the sequence is highly similar.
# sno/sca:
# * The sequences for the sno/sca and hairpin probesets are the entire sequences, not just the SIF regions.
 
Submission date Dec 17, 2012
Last update date Jul 25, 2018
Organization Affymetrix, Inc.
E-mail(s) geo@ncbi.nlm.nih.gov, support@affymetrix.com
Phone 888-362-2447
URL http://www.affymetrix.com/index.affx
Street address
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
 
Samples (3345) GSM1054922, GSM1054923, GSM1054924, GSM1054925, GSM1054926, GSM1054927 
Series (191)
GSE43009 miRNA data in colon mucosa samples from individuals with ulcerative colitis and normal controls
GSE43766 identification of miRNA differential expression patterns in a new model of acquired letrozole resistance
GSE44265 HIV-1 Tat protein promotes neuronal dysfunction through disruption of microRNAs.
Relations
Alternative to GPL20762

Data table header descriptions
ID
Species Scientific Name
Annotation Date
Sequence Type
Sequence Source
Transcript ID(Array Design)
Alignments
Sequence Length
Sequence
miRNA_ID_LIST
SPOT_ID

Data table
ID Species Scientific Name Annotation Date Sequence Type Sequence Source Transcript ID(Array Design) Alignments Sequence Length Sequence miRNA_ID_LIST SPOT_ID
14q0_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14q0 chr14:101364257-101364333 (+) 77 TGGACCAATGATGAGACAGTGTTTATGAACAAAAGATCATGATTAATCCAGTTCTGCACAAAACACTGAGGTCCATT CDBox: 14q0
14qI-1_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-1 chr14:101391158-101391227 (+) 70 AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCC CDBox: 14qI-1
14qI-1_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-1 chr14:101391158-101391227 (+) 70 AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCC CDBox: 14qI-1
14qI-2_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-2 chr14:101393679-101393749 (+) 71 ATAGCCAATCATTAGTATTCTGAGCTGTAGGAATCAAAGATTTTGATTAGATTCTGTAACTCAGAGGTTTA CDBox: 14qI-2
14qI-3_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-3 chr14:101396256-101396326 (+) 71 TAGACCAATGATGAGTATTCTGGGGTGTCTGAATCAATGATTTTGATTAAACCCTGTAACTCTGAGGTCCA CDBox: 14qI-3
14qI-4_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-4 chr14:101402828-101402901 (+) 74 TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA CDBox: 14qI-4
14qI-4_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-4 chr14:101402828-101402901 (+) 74 TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA CDBox: 14qI-4
14qI-5_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-5 chr14:101404524-101404600 (+) 77 TGGATCAATGATGAGTATTGGTGGAGGTGTCTGAATCAACACTTTTGATTAAGCCCTCTGTGTAACTCTGAGATCTG CDBox: 14qI-5
14qI-6_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-6 chr14:101405893-101405966 (+) 74 TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA CDBox: 14qI-6
14qI-6_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-6 chr14:101405893-101405966 (+) 74 TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA CDBox: 14qI-6
14qI-7_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-7 chr14:101407463-101407538 (+) 76 TGGATCAATGATGAGTATGCGTGGGGCATCTGAATCAAATATTCTGATTATACCCTGTCTGTATCTCTGAGGTCCA CDBox: 14qI-7
14qI-8_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-8 chr14:101409788-101409860 (+) 73 TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA CDBox: 14qI-8
14qI-8_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-8 chr14:101409788-101409860 (+) 73 TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA CDBox: 14qI-8
14qI-9_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qI-9 chr14:101411986-101412056 (+) 71 TGGATCAATGATGAGTACCCTGGGGTGTCTGAATCTTGGATTTTGATTAAACCCTATAACTCTGAGGTCCA CDBox: 14qI-9
14qII-10_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qII-10 chr14:101433389-101433459 (+) 71 AAGATCAATGATGACTACTGTTAGTGTATGAGTTACACATGATGAATACATGTCTGAAACTCTGAGGTCCA CDBox: 14qII-10
14qII-10_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qII-10 chr14:101433389-101433459 (+) 71 AAGATCAATGATGACTACTGTTAGTGTATGAGTTACACATGATGAATACATGTCTGAAACTCTGAGGTCCA CDBox: 14qII-10
14qII-11_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qII-11 chr14:101434448-101434521 (+) 74 TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA CDBox: 14qII-11
14qII-11_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qII-11 chr14:101434448-101434521 (+) 74 TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA CDBox: 14qII-11
14qII-12_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qII-12 chr14:101435285-101435358 (+) 74 TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA CDBox: 14qII-12
14qII-12_x_st Homo sapiens 14-Oct-11 CDBox Affymetrix Proprietary Database 14qII-12 chr14:101435285-101435358 (+) 74 TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA CDBox: 14qII-12

Total number of rows: 25533

Table truncated, full table size 4436 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL16384_miRNA-3_1-st-v1.annotations.20140513.csv.gz 21.2 Mb (ftp)(http) CSV

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap