NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL16956 Query DataSets for GPL16956
Status Public on Apr 05, 2013
Title Agilent-045997 Arraystar human lncRNA microarray V3 (Probe Name Version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
 
Submission date Apr 03, 2013
Last update date Mar 12, 2018
Contact name Panos Pan
E-mail(s) panosp@arraystar.com
Phone 888-416-6343
Organization name Arraystar Inc.
Street address 9430 Key West Avenue
City Rockville
State/province MD
ZIP/Postal code 20850
Country USA
 
Samples (1140) GSM1330522, GSM1330523, GSM1330524, GSM1330525, GSM1330526, GSM1330527 
Series (117)
GSE55146 Aberrant expression of long noncoding RNA in vivo in the cystic fibrosis bronchial epithelium.
GSE59245 Long noncoding RNAs expression patterns associated with chemo response to cisplatin based chemotherapy in lung squamous cell carcinoma patients
GSE60689 Identification of LncRNA Expression Signatures for Triple-negative Breast Cancer
Relations
Alternative to GPL24721 (Feature Number version)

Data table header descriptions
ID probeID
TRANSCRIPT_TYPE protein-coding or noncoding
BUILD
SEQUENCE
SPOT_ID

Data table
ID TRANSCRIPT_TYPE BUILD SEQUENCE SPOT_ID
ASHGA5P000001 noncoding HG19 GAGATAACTAGAACAGTGTCCCTCCCCTTTTATAACCTGTGTTTTTAGATTTCAAAAAGA --unmapped
ASHGA5P000002 noncoding HG19 CTAACTGTCAAACAAAGATGGGCTAATTAAACGGATGCCAACTAATCGGAAAACTTCTGG --unmapped
ASHGA5P000003 noncoding HG19 CCAGAAGCTCCAGCATGGTCCACCTACCAGAAGCTCCAGCATGATTTACCCATGAGTAGC --unmapped
ASHGA5P000004 noncoding HG19 TAAGTACGGTAATGCAAGAAGGTGCAGCAGGCGTAGTGCATTACAGCAACACTGAAAAAC --unmapped
ASHGA5P000005 noncoding HG19 TATGAGAGATGAAGAGATAAGGTCTAACTGTTACCTGGGCTGAACCCTTGGACTTCTAGG --unmapped
ASHGA5P000006 noncoding HG19 CAGTAGCGAGTATTTACTAAGTACTTTCTATTTGCGAGGCCCTGATAAAAGTACTGTCCT --unmapped
ASHGA5P000007 noncoding HG19 AATCTATTTATCTTCTCTGGAACTTCTTGTAATGCCGGGAGTGCAGAGCTTACAAGTTGG --unmapped
ASHGA5P000008 noncoding HG19 TAGCTGTAAGTAAGAATAGTTCATCACCCACTGCTGGGTTTGCATCCTCCTCCAAATAGG --unmapped
ASHGA5P000009 noncoding HG19 GAAATGTTTGTCTCTTCATGTTTCTCTGTCTTTCCCTTTCTCAAAGTAACAACTTGGGTT --unmapped
ASHGA5P000010 noncoding HG19 GACCATTCCAGTATCCTTACCTTACAGAAATGACAGCAACAACAGCAAATATGAGTAAAG --unmapped
ASHGA5P000011 noncoding HG19 AAGTCTCACAGAAATCCAGGAGACTTAAATGATCCAAGGGCAGGAAAGAAGGCTGCTCAT --unmapped
ASHGA5P000012 noncoding HG19 CTTCTGGATTTCAAATGTTGCTGTGCTCACAGAAACCTGATGGTTTACACACCAAGCAAT --unmapped
ASHGA5P000013 noncoding HG19 GGTGACTTACCTCAGTTGTAGGTATGAATCTATAGCCAAGGATTATGAAAACCTGAAGAA --unmapped
ASHGA5P000014 noncoding HG19 CTTCATTTAACCTTGTTGCTTTGAGTACTCCTAAAGCTTGTAATAATTCTTTGGGGAGTA --unmapped
ASHGA5P000015 noncoding HG19 GAAGCCTCAGGTGTATGCATGTCTGTTCGTATGTTGTCTACATAATACCAAGTTGACTTC --unmapped
ASHGA5P000016 noncoding HG19 GTTCCTACAGTGACAACTGGACCTGGCCCGAACCCCTGGCATCTGGCAACATTATTACCT --unmapped
ASHGA5P000017 noncoding HG19 TGGCAGCACGGCATATCCGCTGGCCTTCTGGGCACCAATGACAATGAAGCAGGCAATGAG --unmapped
ASHGA5P000018 noncoding HG19 CAGTCACTCTATGTCTTGCACCCAATTTAATGAATCTGAATTGATTATTCAGGTTGGTTT --unmapped
ASHGA5P000019 noncoding HG19 AACTCACCAGACCACAACTTGCAGCTCACAACACAACAGGAAGCTTAAAGATGCTTTGCT --unmapped
ASHGA5P000020 noncoding HG19 TTCTCCAGGATATTTTGGCCACAGACTTTATCATAAACTCCATCCCTTAGGGTGGCATTA --unmapped

Total number of rows: 58944

Table truncated, full table size 5941 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap