NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL17077 Query DataSets for GPL17077
Status Public on Apr 26, 2013
Title Agilent-039494 SurePrint G3 Human GE v2 8x60K Microarray 039381 (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description SurePrint G3 Human GE v2 8x60K Microarray

Design ID: 039494
Design Format: 8 x 60 K
Control Grid: IS-62976-8-V2_60kby8_GX_EQC_201000210
Build Version: hg19:GRCh37:Feb2009

Arrays of this design have barcodes that begin with 16039494 or 2539494.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Probe Names.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

 
Submission date Apr 26, 2013
Last update date Jan 09, 2018
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (7403) GSM1086291, GSM1086292, GSM1094647, GSM1094648, GSM1094649, GSM1094650 
Series (506)
GSE44550 THP-1 cells treated with CXCL14
GSE44964 Integrated genomic and prospective clinical studies show the importance of modular pleiotropy for disease susceptibility, diagnosis and treatment (dataset 2)
GSE44966 Integrated genomic and prospective clinical studies show the importance of modular pleiotropy for disease susceptibility, diagnosis and treatment
Relations
Alternative to GPL16699

Data table header descriptions
ID Agilent Probe Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBank Accession number
LOCUSLINK_ID LocuslinkID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
GE_BrightCorner CONTROL pos
DarkCorner CONTROL pos
A_23_P117082 A_23_P117082 FALSE NM_015987 NM_015987 50865 HEBP1 heme binding protein 1 Hs.642618 ENST00000014930 ref|NM_015987|ens|ENST00000014930|gb|AF117615|gb|BC016277 chr12:13127906-13127847 hs|12p13.1 Homo sapiens heme binding protein 1 (HEBP1), mRNA [NM_015987] GO:0005488(binding)|GO:0005576(extracellular region)|GO:0005737(cytoplasm)|GO:0005739(mitochondrion)|GO:0005829(cytosol)|GO:0007623(circadian rhythm)|GO:0020037(heme binding) AAGGGGGAAAATGTGATTTGTGCCTGATCTTTCATCTGTGATTCTTATAAGAGCTTTGTC
A_33_P3246448 A_33_P3246448 FALSE NM_080671 NM_080671 23704 KCNE4 potassium voltage-gated channel, Isk-related family, member 4 Hs.348522 ENST00000281830 ref|NM_080671|ens|ENST00000281830|tc|THC2655788 chr2:223920197-223920256 hs|2q36.1 Homo sapiens potassium voltage-gated channel, Isk-related family, member 4 (KCNE4), mRNA [NM_080671] GO:0005244(voltage-gated ion channel activity)|GO:0005249(voltage-gated potassium channel activity)|GO:0006811(ion transport)|GO:0006813(potassium ion transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016324(apical plasma membrane) GCAAGTCTCTCTGCACCTATTAAAAAGTGATGTATATACTTCCTTCTTATTCTGTTGAGT
A_33_P3318220 A_33_P3318220 FALSE NM_178466 NM_178466 128861 BPIFA3 BPI fold containing family A, member 3 Hs.360989 ENST00000375454 ref|NM_178466|ens|ENST00000375454|ens|ENST00000471233|tc|THC2478474 chr20:31812208-31812267 hs|20q11.21 Homo sapiens BPI fold containing family A, member 3 (BPIFA3), transcript variant 1, mRNA [NM_178466] GO:0005576(extracellular region)|GO:0008289(lipid binding) CATTCCATAAGGAGTGGTTCTCGGCAAATATCTCACTTGAATTTGACCTTGAATTGAGAC
A_33_P3236322 A_33_P3236322 FALSE AK128005 100129869 LOC100129869 uncharacterized LOC100129869 gb|AK128005|tc|THC2484382 chr20:56533874-56533815 hs|20q13.32 Homo sapiens cDNA FLJ46124 fis, clone TESTI2040372. [AK128005] ATTTATTTTCACAAGTGCATAGCGGCCAACACCACCAGCACTAACCAGAGTGGATTCTTG
A_33_P3319925 A_33_P3319925 FALSE XM_001133269 XM_001133269 730249 IRG1 immunoresponsive 1 homolog (mouse) Hs.160789 ENST00000449753 ens|ENST00000449753|ens|ENST00000377462|ref|XM_001133269|ref|XM_003403661 chr13:77532009-77532068 hs|13q22.3 immunoresponsive 1 homolog (mouse) [Source:HGNC Symbol;Acc:33904] [ENST00000449753] GO:0019543(propionate catabolic process)|GO:0032496(response to lipopolysaccharide)|GO:0047547(2-methylcitrate dehydratase activity) AGAAGACCTAGAAGACTGTTCTGTGTTAACTACACTTCTCAAAGGACCCTCTCCACCAGA
A_21_P0000509 A_21_P0000509 FALSE NR_024244 NR_024244 SNAR-G2 small ILF3/NF90-associated RNA G2 Hs.717308 ref|NR_024244 chr19:49534993-49534934 hs|19q13.33 Homo sapiens small ILF3/NF90-associated RNA G2 (SNAR-G2), small nuclear RNA [NR_024244] AGGGGAGGGTTCGAGGGTACGAGTTCGAGGCCAACCGGGTCCACATTGGTTGAGAAAAAA
A_21_P0000744 A_21_P0000744 FALSE NR_038269 NR_038269 LOC100506844 uncharacterized LOC100506844 Hs.90286 ENST00000551421 ref|NR_038269|ens|ENST00000551421|ens|ENST00000546580|ens|ENST00000553102 chr12:58329728-58329669 hs|12q14.1 Homo sapiens uncharacterized LOC100506844 (LOC100506844), non-coding RNA [NR_038269] AGTCGTACCCTCTTGTTTTTCTCTGAGTCAGTCTTAAGGTGAAATGAAGTGTGGCCCAGT
A_24_P215804 A_24_P215804 FALSE NM_016951 NM_016951 51192 CKLF chemokine-like factor Hs.15159 ref|NM_016951|ref|NM_181641|ref|NM_181640|ref|NM_016326 chr16:66599900-66599959 hs|16q21 Homo sapiens chemokine-like factor (CKLF), transcript variant 1, mRNA [NM_016951] GO:0005576(extracellular region)|GO:0005615(extracellular space)|GO:0006935(chemotaxis)|GO:0008009(chemokine activity)|GO:0008283(cell proliferation)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0030593(neutrophil chemotaxis)|GO:0032940(secretion by cell)|GO:0048246(macrophage chemotaxis)|GO:0048247(lymphocyte chemotaxis) AAAGAAGTTTTGTAATTTTATATTACTTTTTAGTTTGATACTAAGTATTAAACATATTTC
A_23_P110167 A_23_P110167 FALSE NM_002413 NM_002413 4258 MGST2 microsomal glutathione S-transferase 2 Hs.81874 ref|NM_002413|ref|NM_001204368|ref|NM_001204366|ref|NM_001204367 chr4:140625256-140625315 hs|4q31.1 Homo sapiens microsomal glutathione S-transferase 2 (MGST2), transcript variant 1, mRNA [NM_002413] GO:0002540(leukotriene production involved in inflammatory response)|GO:0004364(glutathione transferase activity)|GO:0004464(leukotriene-C4 synthase activity)|GO:0004602(glutathione peroxidase activity)|GO:0005624(membrane fraction)|GO:0005737(cytoplasm)|GO:0005783(endoplasmic reticulum)|GO:0005789(endoplasmic reticulum membrane)|GO:0005792(microsome)|GO:0005886(plasma membrane)|GO:0006750(glutathione biosynthetic process)|GO:0006805(xenobiotic metabolic process)|GO:0008047(enzyme activator activity)|GO:0010243(response to organic nitrogen)|GO:0016021(integral to membrane)|GO:0016740(transferase activity)|GO:0019370(leukotriene biosynthetic process)|GO:0031965(nuclear membrane)|GO:0032496(response to lipopolysaccharide) AATATCTGGACCTCAATATTGCCAAGAAACTGAGGCGGCAATTCTAACTTTTTCTCTTCC
A_33_P3211513 A_33_P3211513 FALSE NM_001162407 NM_001162407 1195 CLK1 CDC-like kinase 1 Hs.433732 ENST00000357369 ref|NM_001162407|ref|NM_004071|ref|NR_027855|ens|ENST00000357369 chr2:201726021-201725962 hs|2q33.1 Homo sapiens CDC-like kinase 1 (CLK1), transcript variant 2, mRNA [NM_001162407] GO:0000166(nucleotide binding)|GO:0004674(protein serine/threonine kinase activity)|GO:0004712(protein serine/threonine/tyrosine kinase activity)|GO:0004715(non-membrane spanning protein tyrosine kinase activity)|GO:0005524(ATP binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0008283(cell proliferation)|GO:0018105(peptidyl-serine phosphorylation)|GO:0018107(peptidyl-threonine phosphorylation)|GO:0018108(peptidyl-tyrosine phosphorylation)|GO:0043484(regulation of RNA splicing)|GO:0046777(protein autophosphorylation) AAGTAGTTATAAAAGCAAACACAGGATTCACCACAGTACTTCACATCGTCGTTCACATGG
A_23_P103349 A_23_P103349 FALSE NM_022375 NM_022375 10896 OCLM oculomedin Hs.679230 ref|NM_022375|gb|BC069096|gb|AF142063|tc|THC2484909 chr1:186370135-186370194 hs|1q31.1 Homo sapiens oculomedin (OCLM), mRNA [NM_022375] GO:0007601(visual perception) GTGTATATTATAGCTGCATTGCAGGTTTCAGGATTTGCAGGGTATGGGGATGTATCCACC
A_32_P61480 A_32_P61480 FALSE NR_026941 NR_026941 255082 CASC2 cancer susceptibility candidate 2 (non-protein coding) Hs.89387 ref|NR_026941|gb|AJ535620|gb|BC112326|gb|AJ344228 chr10:119859230-119859289 hs|10q26.11 Homo sapiens cancer susceptibility candidate 2 (non-protein coding) (CASC2), transcript variant 3, non-coding RNA [NR_026941] TAATTACTTATATTGATGTTCTTCCTACGTCTAAGAAAAATGTTATTTCCATTCCCAAGA
A_33_P3788124 A_33_P3788124 FALSE NR_026646 NR_026646 791114 PWRN1 Prader-Willi region non-protein coding RNA 1 Hs.720900 ref|NR_026646|gb|AK058147|gb|BC034815|tc|NP1154364 chr15:24832860-24832919 hs|15q11.2 Homo sapiens Prader-Willi region non-protein coding RNA 1 (PWRN1), non-coding RNA [NR_026646] CTTTTGAGCCACTAAGCTACATGGTAATAGGCTATGCTTCAATAAACAATAATACACTTG
A_33_P3414202 A_33_P3414202 FALSE NM_001170704 NM_001170704 55796 MBNL3 muscleblind-like 3 (Drosophila) Hs.105134 ref|NM_001170704|ref|NM_018388|ref|NM_001170701|ref|NM_001170702 chrX:131516295-131516236 hs|Xq26.2 Homo sapiens muscleblind-like 3 (Drosophila) (MBNL3), transcript variant 6, mRNA [NM_001170704] GO:0003676(nucleic acid binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005794(Golgi apparatus)|GO:0006397(mRNA processing)|GO:0007275(multicellular organismal development)|GO:0008270(zinc ion binding)|GO:0043231(intracellular membrane-bounded organelle)|GO:0043484(regulation of RNA splicing)|GO:0045662(negative regulation of myoblast differentiation)|GO:0046872(metal ion binding) ATGATGCACGGTGCTACACCTACCACTGTGTCTGCAGCAACAACACCTGCCACCAGCGTT
A_33_P3316686 A_33_P3316686 FALSE NM_016230 NM_016230 51167 CYB5R4 cytochrome b5 reductase 4 Hs.5741 ENST00000369679 ref|NM_016230|ens|ENST00000369679|ens|ENST00000369681|gb|CU692982 chr6:84618749-84618808 hs|6q14.2 Homo sapiens cytochrome b5 reductase 4 (CYB5R4), mRNA [NM_016230] GO:0003032(detection of oxygen)|GO:0004128(cytochrome-b5 reductase activity)|GO:0005783(endoplasmic reticulum)|GO:0006091(generation of precursor metabolites and energy)|GO:0006801(superoxide metabolic process)|GO:0016174(NAD(P)H oxidase activity)|GO:0016491(oxidoreductase activity)|GO:0016653(oxidoreductase activity, acting on NADH or NADPH, heme protein as acceptor)|GO:0020037(heme binding)|GO:0030073(insulin secretion)|GO:0042593(glucose homeostasis)|GO:0046677(response to antibiotic)|GO:0046872(metal ion binding)|GO:0048468(cell development)|GO:0048471(perinuclear region of cytoplasm)|GO:0055114(oxidation-reduction process) GAATCCATGCTGAAAGAATGCCTGGTTGGCAGAATGGCCATTAAACCTGCTGTTCTGAAA
A_33_P3300975 A_33_P3300975 FALSE NM_014620 NM_014620 3221 HOXC4 homeobox C4 Hs.549040 ENST00000430889 ref|NM_014620|ref|NM_153633|ens|ENST00000430889|gb|BC050442 chr12:54449755-54449814 hs|12q13.13 Homo sapiens homeobox C4 (HOXC4), transcript variant 1, mRNA [NM_014620] GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0005634(nucleus)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0007275(multicellular organismal development)|GO:0009952(anterior/posterior pattern formation)|GO:0043565(sequence-specific DNA binding)|GO:0048562(embryonic organ morphogenesis)|GO:0051216(cartilage development) TAGTGTCGATGTGAAATGCCCCGTGATCAATAATAAACCAGTGGATGTGAATTAGTTTTA
A_33_P3263061 A_33_P3263061 FALSE NM_016282 NM_016282 50808 AK3 adenylate kinase 3 Hs.493362 ref|NM_016282|ref|NM_001199852|ref|NM_001199854|ref|NM_001199856 chr9:4711217-4711158 hs|9p24.1 Homo sapiens adenylate kinase 3 (AK3), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA [NM_016282] GO:0000166(nucleotide binding)|GO:0004017(adenylate kinase activity)|GO:0005524(ATP binding)|GO:0005525(GTP binding)|GO:0005739(mitochondrion)|GO:0005759(mitochondrial matrix)|GO:0006139(nucleobase, nucleoside, nucleotide and nucleic acid metabolic process)|GO:0006756(AMP phosphorylation)|GO:0007596(blood coagulation)|GO:0016740(transferase activity)|GO:0019205(nucleobase, nucleoside, nucleotide kinase activity)|GO:0042802(identical protein binding)|GO:0046899(nucleoside triphosphate adenylate kinase activity) TGCTGCCTGATGTCTCAATGGCTTCTGAATGACTGTTCTAATAAATGATCTTAAAACAGT
A_33_P3261373 ens|ENST00000319813|tc|NP511499 FALSE ENST00000319813 ens|ENST00000319813|tc|NP511499 chr11:48387097-48387038 hs|11p11.2 olfactory receptor, family 4, subfamily C, member 5 [Source:HGNC Symbol;Acc:14702] [ENST00000319813] GAAAAATGCCATGAAGCAGCTCTGGAGCCAAATAATCTGGGGTAACAATTTGTGTGATTA

Total number of rows: 50739

Table truncated, full table size 27046 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap