NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL1708 Query DataSets for GPL1708
Status Public on Nov 17, 2004
Title Agilent-012391 Whole Human Genome Oligo Microarray G4112A (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4112A
 
Description This single 44K formatted microarray represents a compiled view of the human genome as it is understood today. The sequence information used to design this product was derived from a broad survey of well known sources such as RefSeq, Goldenpath, Ensembl, Unigene and others. The resulting view of the human genome covers 41K unique genes and transcripts which have been verified and optimized by alignment to the human genome assembly and by Agilent's Empirical Validation process.

Arrays of this design have barcodes that begin with 16012391 or 2512391.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL6848.
 
Submission date Nov 17, 2004
Last update date Dec 06, 2012
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (3314) GSM36720, GSM36726, GSM36727, GSM36728, GSM36729, GSM36730 
Series (136)
GSE2035 Hearts_DD_Screening
GSE2740 Estrogen-regulated genes predict survival in estrogen receptor and/or progesterone receptor-positive breast cancers
GSE3155 Gene expression profiling of the 20 human early breast carcinomas by three miaroarray platforms
Relations
Alternative to GPL6848

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 103 430 BrightCorner BrightCorner pos
2 103 428 NegativeControl NegativeControl neg
3 103 426 NM_001003689 A_23_P80353 FALSE NM_001003689 NM_001003689 83746 L3MBTL2 l(3)mbt-like 2 (Drosophila) Hs.517641 ENST00000216237 THC2264916 ref|NM_001003689|ref|NM_031488|gb|AL136564|ens|ENST00000216237 chr22:39950687-39950746 hs|22q13.2 Homo sapiens l(3)mbt-like 2 (Drosophila) (L3MBTL2), transcript variant 2, mRNA [NM_001003689] GO:0003714(transcription corepressor activity)|GO:0005634(nucleus)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0008270(zinc ion binding)|GO:0016568(chromatin modification)|GO:0046872(metal ion binding) CCCGACAAGGCTTCAAGTCCAGAGCTGCCTGTCTCCGTCGAGAACATCAAGCAGGAAACA
4 103 424 NM_005503 A_23_P158231 FALSE NM_005503 NM_005503 321 APBA2 amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like) Hs.525718 ENST00000219865 THC2241506 ref|NM_005503|gb|BC082986|gb|AF029108|ens|ENST00000219865 chr15:27193462-27196566 hs|15q13.1 Homo sapiens amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like) (APBA2), mRNA [NM_005503] GO:0005515(protein binding)|GO:0007399(nervous system development)|GO:0015031(protein transport) CCACAGCCCACGAGAAGATAGTCCAAGCTCTGTCCAACTCGGTCGGAGAGATCCACATGA
5 103 422 NM_004672 A_32_P223017 FALSE NM_004672 NM_004672 9064 MAP3K6 mitogen-activated protein kinase kinase kinase 6 Hs.194694 ENST00000357582 THC2236536 ref|NM_004672|gb|AB208805|ens|ENST00000357582|ens|ENST00000374036 chr1:27366686-27366347 hs|1p36.11 Homo sapiens mitogen-activated protein kinase kinase kinase 6 (MAP3K6), mRNA [NM_004672] GO:0000166(nucleotide binding)|GO:0004674(protein serine/threonine kinase activity)|GO:0005524(ATP binding)|GO:0006468(protein amino acid phosphorylation)|GO:0016301(kinase activity)|GO:0016740(transferase activity) GAATGTGGATTCAGGCACCATCCAAATGCTGTTGAACCATAGCTTCACCCTCCACACTCT
6 103 420 NM_001008727 A_24_P935782 FALSE NM_001008727 NM_001008727 7675 ZNF121 zinc finger protein 121 (clone ZHC32) Hs.501537 ENST00000320451 THC2427892 ref|NM_001008727|ens|ENST00000320451|thc|THC2427892 chr19:9538344-9538285 hs|19p13.2 Homo sapiens zinc finger protein 121 (clone ZHC32) (ZNF121), mRNA [NM_001008727] GO:0003677(DNA binding)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0006350(transcription)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0008270(zinc ion binding)|GO:0046872(metal ion binding) TGTGGAAAATTCTTTAGATATTCTTCATATCTTAATAGTCACATGCGAACCCATACTGGG
7 103 418 Pro25G Pro25G pos
8 103 416 NM_020630 A_24_P343695 FALSE NM_020630 NM_020630 5979 RET ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) Hs.350321 ENST00000340058 THC2310316 ref|NM_020630|gb|BC003072|gb|M16029|gb|L03357 chr10:42937418-42939131 hs|10q11.21 Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 4, mRNA [NM_020630] GO:0000166(nucleotide binding)|GO:0004713(protein-tyrosine kinase activity)|GO:0004872(receptor activity)|GO:0005509(calcium ion binding)|GO:0005524(ATP binding)|GO:0006468(protein amino acid phosphorylation)|GO:0007156(homophilic cell adhesion)|GO:0007165(signal transduction)|GO:0007166(cell surface receptor linked signal transduction)|GO:0007497(posterior midgut development)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016301(kinase activity)|GO:0016740(transferase activity) TGGATGGCAATTGAATCCCTTTTTGATCATATCTACACCACGCAAAGTGATGTATGGTCT
9 103 414 BX094364 A_32_P109901 FALSE BX094364 Hs.124584 THC2407425 gb|BX094364|thc|THC2407425 chr18:11643410-11643351 hs|18p11.21 BX094364 Soares_testis_NHT Homo sapiens cDNA clone IMAGp998D074163, mRNA sequence [BX094364] GTGGTAACATAAAGTTTCAAGTTCAAAGTTTATGTGTCCTTCCTTACTCCCGGTGGAGTG
10 103 412 ENST00000333722 A_32_P158786 FALSE XM_056680 BC015121 Hs.535190 ENST00000333722 THC2309386 ens|ENST00000333722|gb|BC015121|gb|BC014352|gb|BC039369 chr12:62954959-62950714 hs|12q14.2 Homo sapiens chromosome 12 open reading frame 56, mRNA (cDNA clone IMAGE:3685952). [BC015121] GO:0005524(ATP binding)|GO:0015986(ATP synthesis coupled proton transport)|GO:0016469(proton-transporting two-sector ATPase complex)|GO:0046933(hydrogen-transporting ATP synthase activity, rotational mechanism)|GO:0046961(hydrogen-transporting ATPase activity, rotational mechanism) TGTCCTCCCATCATTACTTTTGTGGCCAGTATTGTGAAACAAGTGGTGAGGGGTCTTTCA
11 103 410 E1A_r60_a20 E1A_r60_a20 pos
12 103 408 NM_003927 A_23_P15864 FALSE NM_003927 NM_003927 8932 MBD2 methyl-CpG binding domain protein 2 Hs.25674 ENST00000256429 THC2234702 ref|NM_003927|gb|BC032638|gb|CR592999|ens|ENST00000256429 chr18:49935450-49935391 hs|18q21.2 Homo sapiens methyl-CpG binding domain protein 2 (MBD2), transcript variant 1, mRNA [NM_003927] GO:0003677(DNA binding)|GO:0003696(satellite DNA binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0006350(transcription)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0008327(methyl-CpG binding)|GO:0016481(negative regulation of transcription)|GO:0016564(transcriptional repressor activity) GACCCTAAGATGAAGCTGAGCTTTTGATGCCAGGTGCAATCTACTGGAAATGTAGCACTT
13 103 406 BC038371 A_32_P171530 FALSE BC038371 Hs.133421 THC2338508 gb|BC038371|thc|THC2338508 chr5:38593473-38593532 hs|5p13.1 Homo sapiens cDNA clone IMAGE:4829282. [BC038371] CAAGGCCAACGTGTTTTTTAAAGACCTTTCGATGAAACTCCAAAGCAATTTATAAATTGG
14 103 404 Pro25G Pro25G pos
15 103 402 NM_153610 A_24_P925413 FALSE NM_153610 NM_153610 202333 CMYA5 cardiomyopathy associated 5 Hs.482625 ENST00000238522 THC2311177 ref|NM_153610|ens|ENST00000238522|gb|AF177292|gb|BC063134 chr5:79067786-79067845 hs|5q14.1 Homo sapiens cardiomyopathy associated 5 (CMYA5), mRNA [NM_153610] GO:0005554(molecular function unknown)|GO:0008372(cellular component unknown) CCCCATTAGAGCTTAGAGATAGTAATGAAATAGGGAAGACACAAATTACACTTGGATCTA
16 103 400 NM_181645 A_24_P305993 FALSE NM_181645 NM_181645 159989 CCDC67 coiled-coil domain containing 67 Hs.436625 ENST00000354243 NP404677 ref|NM_181645|ens|ENST00000354243|ens|ENST00000298050|gb|BC017929 chr11:92743969-92744028 hs|11q21 Homo sapiens coiled-coil domain containing 67 (CCDC67), mRNA [NM_181645] AGAGATGAGTTCATTATTGAAAAACTGAAATCAGCTGTAAATGAGATAGCACTAAGCAGG
17 103 398 NM_032809 A_24_P166931 FALSE NM_032809 NM_032809 84895 FAM73B family with sequence similarity 73, member B Hs.632693 ENST00000358369 THC2246213 ref|NM_032809|gb|BC009114|ens|ENST00000358369|ens|ENST00000349214 chr9:128909700-128910085 hs|9q34.11 Homo sapiens family with sequence similarity 73, member B (FAM73B), mRNA [NM_032809] GAGGGGTGGTATGCATGAGCTTCTTCGACATCGTGCTGGACTTCATCCTCATGGACGCCT
18 103 396 NM_005656 A_23_P29067 FALSE NM_005656 NM_005656 7113 TMPRSS2 transmembrane protease, serine 2 Hs.439309 ENST00000332149 THC2253120 ref|NM_005656|gb|AK123948|gb|BC051839|ens|ENST00000332149 chr21:41758833-41758774 hs|21q22.3 Homo sapiens transmembrane protease, serine 2 (TMPRSS2), mRNA [NM_005656] GO:0004252(serine-type endopeptidase activity)|GO:0005044(scavenger receptor activity)|GO:0005887(integral to plasma membrane)|GO:0006508(proteolysis)|GO:0016020(membrane) GAAGAAGAGAAAGATGTGTTTTGTTTTGGACTCTCTGTGGTCCCTTCCAATGCTGTGGGT
19 103 394 BE671816 A_32_P58999 FALSE BE671816 Hs.122337 gb|BE671816 chr15:87544827-87544768 hs|15q26.1 BE671816 7a47d01.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:3221857 3' similar to gb:X12433 PROTEIN PHPS1-2 (HUMAN);, mRNA sequence [BE671816] ACTGGCTACTGGACAAATTGTATATTACCAGATCATCACTAGCAGCTTTCAGTTGCACTT
20 103 392 NM_015904 A_23_P218608 FALSE NM_015904 NM_015904 9669 EIF5B eukaryotic translation initiation factor 5B Hs.158688 ENST00000289371 NP401649 ref|NM_015904|ens|ENST00000289371|gb|CR613918|gb|CR617158 chr2:99474487-99474546 hs|2q11.2 Homo sapiens eukaryotic translation initiation factor 5B (EIF5B), mRNA [NM_015904] GO:0000166(nucleotide binding)|GO:0003743(translation initiation factor activity)|GO:0005515(protein binding)|GO:0005525(GTP binding)|GO:0005622(intracellular)|GO:0006412(protein biosynthesis)|GO:0006446(regulation of translational initiation) GGACACTGATGGACTTAAGTATGGAAGGAAGAAAAATAGGTGTATAAAATGTTTTCCATG

Total number of rows: 44290

Table truncated, full table size 18902 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL1708_old_annotations.txt.gz 5.8 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap