NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL19117 Query DataSets for GPL19117
Status Public on Aug 25, 2014
Title [miRNA-4] Affymetrix Multispecies miRNA-4 Array
Technology type in situ oligonucleotide
Distribution commercial
Organism synthetic construct
Manufacturer Affymetrix
Manufacture protocol See manufacturer's web site
 
Description #%chip_type=miRNA-4_0 or miRNA-4_1
#%create_date=Tue May 13 14:16:15 PDT 2014
#%miRBase_version=v20
 
Submission date Aug 25, 2014
Last update date May 02, 2017
Organization Affymetrix, Inc.
E-mail(s) geo@ncbi.nlm.nih.gov, support@affymetrix.com
Phone 888-362-2447
URL http://www.affymetrix.com/index.affx
Street address
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
 
Samples (1864) GSM1486483, GSM1486484, GSM1486485, GSM1486486, GSM1486487, GSM1486488 
Series (139)
GSE60715 Cells and exosomes after cell-free culture
GSE60716 Cell-Independent MicroRNA Biogenesis
GSE62495 MicroRNA expression data from H1N1 influenza virus infected mouse lung
Relations
Alternative to GPL21572 (ProbeSet ID version)

Data table header descriptions
ID Probe Set Name
Probe Set ID
Accession
Transcript ID(Array Design)
Sequence Type
Species Scientific Name
Alignments
Sequence Length
Sequence
Genome Context
Clustered miRNAs within 10kb
Target Genes
GeneChip Array
Annotation Date
Sequence Source
miRNA_ID
SPOT_ID

Data table
ID Probe Set ID Accession Transcript ID(Array Design) Sequence Type Species Scientific Name Alignments Sequence Length Sequence Genome Context Clustered miRNAs within 10kb Target Genes GeneChip Array Annotation Date Sequence Source miRNA_ID SPOT_ID
MIMAT0000001_st 20500000 MIMAT0000001 cel-let-7-5p miRNA Caenorhabditis elegans X:14744165-14744186 (-) 22 UGAGGUAGUAGGUUGUAUAGUU C05G5.6 // sense // exon // 1 --- MTI // --- // mab-31 /// microcosm // AC7.2a.2 // soc-2 /// microcosm // B0035.6 // B0035.6 /// microcosm // B0035.7 // his-47 /// microcosm // B0222.4 // tag-38 /// microcosm // B0244.10 // B0244.10 /// microcosm // B0284.2 // B0284.2 /// microcosm // B0285.5 // hse-5 /// microcosm // B0334.11a // ooc-3 /// microcosm // B0334.11b // ooc-3 /// microcosm // B0336.6.1 // B0336.6 /// microcosm // B0336.6.2 // B0336.6 /// microcosm // B0336.8 // lgg-3 /// microcosm // B0391.10 // B0391.10 /// microcosm // B0414.2 // rnt-1 /// microcosm // B0507.6 // B0507.6 /// microcosm // B0564.10b // unc-30 /// microcosm // C01B10.5a // hil-7 /// microcosm // C01B10.5b.2 // hil-7 /// microcosm // C01B10.5c // hil-7 /// microcosm // C01F1.4 // C01F1.4 /// microcosm // C01G6.1a.1 // aqp-2 /// microcosm // C01G6.1a.2 // aqp-2 /// microcosm // C01G6.1b.1 // aqp-2 /// microcosm // C02B4.2 // nhr-17 /// microcosm // C02H7.3b // aex-3 /// microcosm // C04F12.6 // C04F12.6 /// microcosm // C04F5.1 // sid-1 /// microcosm // C04G2.4 // msp-36 /// microcosm // C05D12.3c // C05D12.3 /// microcosm // C06A12.5 // C06A12.5 /// microcosm // C06A5.3a // C06A5.3 /// microcosm // C06A5.3b // C06A5.3 /// microcosm // C06B3.9 // str-252 /// microcosm // C06B8.7 // C06B8.7 /// microcosm // C07A12.4a.1 // pdi-2 /// microcosm // C07A12.4a.2 // pdi-2 /// microcosm // C07A12.4b // pdi-2 /// microcosm // C07A12.5b // spr-3 /// microcosm // C07G1.2 // C07G1.2 /// microcosm // C07G1.6 // C07G1.6 /// microcosm // C07H6.6 // clk-2 /// microcosm // C08B6.2 // C08B6.2 /// microcosm // C09B7.1a // ser-7 /// microcosm // C09B7.1b // ser-7 /// microcosm // C09B8.7a.2 // pak-1 /// microcosm // C09D4.3 // C09D4.3 /// microcosm // C09E7.2 // pqn-10 /// microcosm // C09E7.6 // C09E7.6 /// microcosm // C10C5.6a // daf-15 /// microcosm // C10C5.6b // daf-15 /// microcosm // C11D2.1 // C11D2.1 /// microcosm // C12D5.11 // sre-11 /// microcosm // C13C4.2 // nhr-154 /// microcosm // C14A11.2 // C14A11.2 /// microcosm // C14B1.9 // C14B1.9 /// microcosm // C14B9.6b // gei-8 /// microcosm // C14E2.1 // C14E2.1 /// microcosm // C14F11.1b.1 // C14F11.1 /// microcosm // C14F11.1b.2 // C14F11.1 /// microcosm // C15F1.1 // C15F1.1 /// microcosm // C16A3.2 // C16A3.2 /// microcosm // C16B8.4 // C16B8.4 /// microcosm // C16E9.1 // C16E9.1 /// microcosm // C17E4.10.1 // C17E4.10 /// microcosm // C17E4.10.2 // C17E4.10 /// microcosm // C17E4.2 // C17E4.2 /// microcosm // C17H1.5 // C17H1.5 /// microcosm // C18B12.3 // dsc-1 /// microcosm // C18D1.1.2 // die-1 /// microcosm // C18D11.4.1 // rsp-8 /// microcosm // C18F10.8 // srg-7 /// microcosm // C18H7.1.1 // C18H7.1 /// microcosm // C23G10.4b // rpn-2 /// microcosm // C23H3.1 // egl-26 /// microcosm // C24A1.1.1 // flp-24 /// microcosm // C24A1.1.2 // flp-24 /// microcosm // C24A8.4 // cst-2 /// microcosm // C25A1.5 // C25A1.5 /// microcosm // C25F6.2a.1 // dlg-1 /// microcosm // C25F9.1 // srw-85 /// microcosm // C25F9.5.2 // C25F9.5 /// microcosm // C25H3.8 // C25H3.8 /// microcosm // C26C6.1a // tag-185 /// microcosm // C26C6.1b.3 // tag-185 /// microcosm // C26E6.3.1 // C26E6.3 /// microcosm // C27A12.3 // tag-146 /// microcosm // C27A2.4 // C27A2.4 /// microcosm // C27B7.4 // rad-26 /// microcosm // C28D4.9 // nhr-138 /// microcosm // C29E6.5 // nhr-43 /// microcosm // C29F5.2 // sdz-3 /// microcosm // C29F9.8 // C29F9.8 /// microcosm // C29G2.1 // C29G2.1 /// microcosm // C29H12.2.3 // C29H12.2 /// microcosm // C30A5.3.2 // C30A5.3 /// microcosm // C30A5.6 // C30A5.6 /// microcosm // C32B5.9 // C32B5.9 /// microcosm // C32E12.5.2 // sox-1 /// microcosm // C33A12.13 // sru-2 /// microcosm // C33C12.11 // C33C12.11 /// microcosm // C33D9.1a // exc-5 /// microcosm // C33D9.1b // exc-5 /// microcosm // C33D9.8 // C33D9.8 /// microcosm // C33F10.4a // C33F10.4 /// microcosm // C33F10.7a // C33F10.7 /// microcosm // C33G8.2 // C33G8.2 /// microcosm // C33H5.7 // C33H5.7 /// microcosm // C34E10.8 // C34E10.8 /// microcosm // C34F11.4 // msp-50 /// microcosm // C35E7.2a // C35E7.2 /// microcosm // C35E7.2b // C35E7.2 /// microcosm // C36B1.5.1 // C36B1.5 /// microcosm // C36B7.4 // C36B7.4 /// microcosm // C36C9.5 // C36C9.5 /// microcosm // C37A2.3 // C37A2.3 /// microcosm // C37A5.4 // C37A5.4 /// microcosm // C41H7.6 // C41H7.6 /// microcosm // C42D8.8a // apl-1 /// microcosm // C42D8.8b.1 // apl-1 /// microcosm // C42D8.8b.3 // apl-1 /// microcosm // C43G2.2 // C43G2.2 /// microcosm // C44B7.5 // C44B7.5 /// microcosm // C44B9.4 // athp-1 /// microcosm // C44C10.10 // C44C10.10 /// microcosm // C44H4.4 // C44H4.4 /// microcosm // C45E1.1a // nhr-64 /// microcosm // C45H4.1 // srbc-16 /// microcosm // C46H11.4b // lfe-2 /// microcosm // C49D10.6 // nhr-75 /// microcosm // C50B6.3 // C50B6.3 /// microcosm // C50C10.4 // sru-31 /// microcosm // C50H2.5 // C50H2.5 /// microcosm // C52D10.13 // col-138 /// microcosm // C53B7.1.1 // rig-3 /// microcosm // C53B7.1.2 // rig-3 /// microcosm // C53D6.2 // unc-129 /// microcosm // C54C6.5 // C54C6.5 /// microcosm // C56A3.4 // C56A3.4 /// microcosm // D1022.4 // D1022.4 /// microcosm // E02A10.4 // E02A10.4 /// microcosm // E02H1.4 // pme-2 /// microcosm // E04D5.3 // cut-4 /// microcosm // EGAP4.1 // EGAP4.1 /// microcosm // F02A9.4a // F02A9.4 /// microcosm // F02E9.2a // lin-28 /// microcosm // F02E9.2b // lin-28 /// microcosm // F02H6.3a // F02H6.3 /// microcosm // F02H6.3b // F02H6.3 /// microcosm // F07G11.4 // F07G11.4 /// microcosm // F07H5.7 // F07H5.7 /// microcosm // F08A10.1a // F08A10.1 /// microcosm // F08F8.1 // F08F8.1 /// microcosm // F09G2.9.1 // F09G2.9 /// microcosm // F10B5.3.1 // F10B5.3 /// microcosm // F10B5.3.2 // F10B5.3 /// microcosm // F10E9.8 // sas-4 /// microcosm // F10G2.2 // F10G2.2 /// microcosm // F11A1.3c // daf-12 /// microcosm // F11D11.10 // F11D11.10 /// microcosm // F13A2.9 // F13A2.9 /// microcosm // F13D11.2a // hbl-1 /// microcosm // F13D11.2b // hbl-1 /// microcosm // F13G11.1a // dmd-6 /// microcosm // F13G11.1b.1 // dmd-6 /// microcosm // F13H8.1b // F13H8.1 /// microcosm // F15A2.3 // srd-51 /// microcosm // F15E11.13 // F15E11.13 /// microcosm // F15E6.1 // F15E6.1 /// microcosm // F17A2.13 // F17A2.13 /// microcosm // F17E9.13 // his-33 /// microcosm // F18C5.10.2 // F18C5.10 /// microcosm // F18C5.2 // wrn-1 /// microcosm // F18E9.3 // F18E9.3 /// microcosm // F19D8.1 // twk-23 /// microcosm // F19H6.1.1 // F19H6.1 /// microcosm // F20C5.6 // F20C5.6 /// microcosm // F21D5.7.1 // F21D5.7 /// microcosm // F21F3.7 // F21F3.7 /// microcosm // F22E12.3 // F22E12.3 /// microcosm // F22E12.4a.1 // egl-9 /// microcosm // F22E12.4d // egl-9 /// microcosm // F22E12.4e.2 // egl-9 /// microcosm // F22E5.11 // F22E5.11 /// microcosm // F22H10.2 // F22H10.2 /// microcosm // F23H11.4a // F23H11.4 /// microcosm // F26A1.14 // F26A1.14 /// microcosm // F26A1.6 // F26A1.6 /// microcosm // F26A10.2 // F26A10.2 /// microcosm // F26C11.3 // F26C11.3 /// microcosm // F26E4.7b // F26E4.7 /// microcosm // F26F2.3 // F26F2.3 /// microcosm // F27B3.2 // acr-21 /// microcosm // F27C1.10 // F27C1.10 /// microcosm // F27D9.1a.2 // unc-18 /// microcosm // F27E11.3a // cfz-2 /// microcosm // F29B9.2a // F29B9.2 /// microcosm // F29B9.2b // F29B9.2 /// microcosm // F29C4.1b // daf-1 /// microcosm // F29F11.1.2 // sqv-4 /// microcosm // F30A10.8a // stn-1 /// microcosm // F30F8.8.1 // taf-5 /// microcosm // F31A9.1 // F31A9.1 /// microcosm // F31D4.5 // F31D4.5 /// microcosm // F31E9.1 // F31E9.1 /// microcosm // F31F4.14 // sru-25 /// microcosm // F33A8.7 // F33A8.7 /// microcosm // F33E2.3 // F33E2.3 /// microcosm // F33H12.6 // F33H12.6 /// microcosm // F33H2.2 // F33H2.2 /// microcosm // F34D6.5 // sri-62 /// microcosm // F35C11.2 // F35C11.2 /// microcosm // F35C5.10 // nspb-11 /// microcosm // F35D11.9 // F35D11.9 /// microcosm // F35F10.1 // F35F10.1 /// microcosm // F35H10.2 // F35H10.2 /// microcosm // F36A2.1a.1 // F36A2.1 /// microcosm // F36D3.3 // srr-3 /// microcosm // F36F12.8 // F36F12.8 /// microcosm // F38H12.3 // nhr-181 /// microcosm // F39D8.2b // psa-3 /// microcosm // F39H11.2 // tlf-1 /// microcosm // F40G9.14 // F40G9.14 /// microcosm // F41D9.3b.1 // wrk-1 /// microcosm // F41D9.3b.2 // wrk-1 /// microcosm // F41D9.3c // wrk-1 /// microcosm // F41D9.3e // wrk-1 /// microcosm // F41E6.4a // smk-1 /// microcosm // F41G3.12 // agr-1 /// microcosm // F42A6.7a.2 // hrp-1 /// microcosm // F42A6.7b.2 // hrp-1 /// microcosm // F42A6.7b.3 // hrp-1 /// microcosm // F42A6.7d // hrp-1 /// microcosm // F42E11.2a // F42E11.2 /// microcosm // F42E11.2c // F42E11.2 /// microcosm // F42G4.3a.1 // zyx-1 /// microcosm // F42H11.2.1 // lem-3 /// microcosm // F43D2.3 // F43D2.3 /// microcosm // F44A6.5 // F44A6.5 /// microcosm // F44E2.3 // F44E2.3 /// microcosm // F44E5.5.2 // F44E5.5 /// microcosm // F45E4.3b.1 // F45E4.3 /// microcosm // F45E4.3b.2 // F45E4.3 /// microcosm // F45E4.9 // hmg-5 /// microcosm // F45E6.4 // F45E6.4 /// microcosm // F46A9.3b // twk-29 /// microcosm // F46B6.7.2 // ztf-7 /// microcosm // F46C8.5 // ceh-14 /// microcosm // F46H5.5 // F46H5.5 /// microcosm // F47H4.1 // F47H4.1 /// microcosm // F48E8.5.4 // paa-1 /// microcosm // F48G7.3 // nhr-83 /// microcosm // F48G7.9 // F48G7.9 /// microcosm // F49E11.4 // tag-254 /// microcosm // F49F1.5 // F49F1.5 /// microcosm // F52B10.3 // F52B10.3 /// microcosm // F52B5.2 // F52B5.2 /// microcosm // F53B1.6 // F53B1.6 /// microcosm // F53C3.3 // F53C3.3 /// microcosm // F53C3.5 // F53C3.5 /// microcosm // F53F10.4.2 // unc-108 /// microcosm // F53F8.2 // srsx-35 /// microcosm // F53G12.6 // spe-8 /// microcosm // F54D5.11 // F54D5.11 /// microcosm // F54D7.4 // zig-7 /// microcosm // F56F11.4a // F56F11.4 /// microcosm // F56G4.2 // pes-2 /// microcosm // F56G4.3 // F56G4.3 /// microcosm // F57B1.6b // F57B1.6 /// microcosm // F57B1.7 // F57B1.7 /// microcosm // F57B7.3 // col-156 /// microcosm // F57F4.2 // F57F4.2 /// microcosm // F58A3.5 // F58A3.5 /// microcosm // F58D2.1 // F58D2.1 /// microcosm // F58E1.9 // fbxb-19 /// microcosm // F58E6.4 // F58E6.4 /// microcosm // F58F9.1 // F58F9.1 /// microcosm // F59A7.11 // F59A7.11 /// microcosm // F59D6.1 // F59D6.1 /// microcosm // F59D6.7 // F59D6.7 /// microcosm // F59H6.4 // F59H6.4 /// microcosm // F59H6.5 // F59H6.5 /// microcosm // H04M03.3 // H04M03.3 /// microcosm // H04M03.6 // srv-19 /// microcosm // H12D21.9 // H12D21.9 /// microcosm // H12I19.4 // H12I19.4 /// microcosm // H20J04.6 // H20J04.6 /// microcosm // H40L08.1 // H40L08.1 /// microcosm // K02A2.1 // K02A2.1 /// microcosm // K02E2.4 // ins-35 /// microcosm // K02F2.6 // ser-3 /// microcosm // K02F6.1 // K02F6.1 /// microcosm // K03H1.7 // K03H1.7 /// microcosm // K04B12.1 // plx-2 /// microcosm // K04H4.6a // crn-6 /// microcosm // K05C4.6 // hmp-2 /// microcosm // K05F1.2 // msp-142 /// microcosm // K05F1.7 // msp-63 /// microcosm // K05F6.2 // fbxb-50 /// microcosm // K07A1.5 // K07A1.5 /// microcosm // K07A12.5 // K07A12.5 /// microcosm // K07F5.11 // ssq-1 /// microcosm // K08A8.1a // mek-1 /// microcosm // K08A8.2a.1 // sox-2 /// microcosm // K08A8.2b.2 // sox-2 /// microcosm // K08B12.1 // K08B12.1 /// microcosm // K08F11.3.1 // K08F11.3 /// microcosm // K08F11.3.3 // K08F11.3 /// microcosm // K08F9.1 // K08F9.1 /// microcosm // K10C9.3 // K10C9.3 /// microcosm // K10G6.1 // lin-31 /// microcosm // K11B4.2 // K11B4.2 /// microcosm // K11H12.11 // K11H12.11 /// microcosm // M01E11.3 // M01E11.3 /// microcosm // M02B1.4 // M02B1.4 /// microcosm // M04D8.1 // ins-21 /// microcosm // M04D8.6 // xbx-3 /// microcosm // M151.8 // fbxb-33 /// microcosm // M163.2 // M163.2 /// microcosm // M163.3 // his-24 /// microcosm // M176.1 // tag-50 /// microcosm // M176.8 // M176.8 /// microcosm // M18.5 // ddb-1 /// microcosm // M57.2.2 // M57.2 /// microcosm // M60.7 // M60.7 /// microcosm // M79.2 // M79.2 /// miRecords // NM_001025828 // lin-41 /// miRecords // NM_001029376 // daf-12 /// miRecords // NM_001047649 // pha-4 /// miRecords // NM_001047778 // hbl-1 /// miRecords // NM_059161 // lss-4 /// miRecords // NM_063774 // die-1 /// miRecords // NM_069812 // let-60 /// microcosm // PAR2.4a.1 // mig-22 /// microcosm // PAR2.4a.3 // mig-22 /// microcosm // R01B10.4 // R01B10.4 /// microcosm // R01B10.6 // R01B10.6 /// microcosm // R01H2.3 // egg-2 /// microcosm // R03C1.3a // cog-1 /// microcosm // R03C1.3b // cog-1 /// microcosm // R03E1.2.1 // R03E1.2 /// microcosm // R03H4.1 // R03H4.1 /// microcosm // R03H4.5 // R03H4.5 /// microcosm // R04A9.6 // R04A9.6 /// microcosm // R04B5.3 // nhr-205 /// microcosm // R04D3.12 // srd-38 /// microcosm // R05A10.3 // R05A10.3 /// microcosm // R05D3.11 // met-2 /// microcosm // R05D3.4a // rfp-1 /// microcosm // R05D3.4b // rfp-1 /// microcosm // R06F6.4 // R06F6.4 /// microcosm // R08C7.3.1 // htz-1 /// microcosm // R08C7.3.2 // htz-1 /// microcosm // R08C7.3.3 // htz-1 /// microcosm // R08C7.9 // fbxb-74 /// microcosm // R10D12.12 // R10D12.12 /// microcosm // R10E11.3a.1 // R10E11.3 /// microcosm // R10E11.3a.2 // R10E11.3 /// microcosm // R10F2.5 // R10F2.5 /// microcosm // R11D1.9 // R11D1.9 /// microcosm // R11F4.2a // R11F4.2 /// microcosm // R144.5 // R144.5 /// microcosm // R53.7b // R53.7 /// microcosm // T01B11.2a.2 // T01B11.2 /// microcosm // T01H8.2 // T01H8.2 /// microcosm // T02G5.2 // T02G5.2 /// microcosm // T02G6.4 // T02G6.4 /// microcosm // T02G6.6 // T02G6.6 /// microcosm // T03D3.2 // srj-50 /// microcosm // T03E6.4 // str-150 /// microcosm // T03E6.7.1 // cpl-1 /// microcosm // T03F7.1.1 // snf-11 /// microcosm // T04A11.8 // sru-19 /// microcosm // T04A8.7a // T04A8.7 /// microcosm // T04A8.7b // T04A8.7 /// microcosm // T04A8.8 // T04A8.8 /// microcosm // T04B2.3b // T04B2.3 /// microcosm // T04C12.7 // T04C12.7 /// microcosm // T04H1.4 // rad-50 /// microcosm // T05A12.4a // T05A12.4 /// microcosm // T05B4.12 // T05B4.12 /// microcosm // T05C12.9 // T05C12.9 /// microcosm // T05G5.9a // T05G5.9 /// microcosm // T05G5.9b // T05G5.9 /// microcosm // T07H8.1 // srx-16 /// microcosm // T08D2.6 // T08D2.6 /// microcosm // T08G5.3 // T08G5.3 /// microcosm // T08H4.3 // ast-1 /// microcosm // T09A12.4d.3 // nhr-66 /// microcosm // T09A5.2a // klp-3 /// microcosm // T09F5.1 // T09F5.1 /// microcosm // T09F5.2 // T09F5.2 /// microcosm // T10C6.1 // str-232 /// microcosm // T10E10.2.1 // col-167 /// microcosm // T10H4.5 // srw-16 /// microcosm // T12E12.1.1 // T12E12.1 /// microcosm // T12E12.3 // T12E12.3 /// microcosm // T13A10.14 // srv-28 /// microcosm // T13A10.5a // nlp-16 /// microcosm // T14B1.1.3 // T14B1.1 /// microcosm // T14G10.6 // tsp-12 /// microcosm // T16H12.1 // T16H12.1 /// microcosm // T17E9.2a // T17E9.2 /// microcosm // T18H9.5a // inx-10 /// microcosm // T19B10.5 // T19B10.5 /// microcosm // T20B12.6a // mml-1 /// microcosm // T20C7.2 // nhr-284 /// microcosm // T20D3.7 // vps-26 /// microcosm // T20G5.9 // T20G5.9 /// microcosm // T21B4.15 // T21B4.15 /// microcosm // T21D12.7 // T21D12.7 /// microcosm // T21D12.9b // T21D12.9 /// microcosm // T21G5.6 // --- /// microcosm // T21H8.3 // sra-38 /// microcosm // T24E12.9 // T24E12.9 /// microcosm // T24F1.2 // T24F1.2 /// microcosm // T25E12.12 // fbxa-127 /// microcosm // T25G12.3 // T25G12.3 /// microcosm // T25G3.1 // T25G3.1 /// microcosm // T25G3.4 // T25G3.4 /// microcosm // T26E3.7 // T26E3.7 /// microcosm // T27B1.2.2 // T27B1.2 /// microcosm // T28A11.7 // srbc-5 /// microcosm // T28B8.1.1 // T28B8.1 /// microcosm // T28B8.1.2 // T28B8.1 /// microcosm // T28H10.2 // T28H10.2 /// microcosm // VF13D12L.1.2 // VF13D12L.1 /// microcosm // W01A8.2 // W01A8.2 /// microcosm // W02B3.7 // W02B3.7 /// microcosm // W02H3.1 // W02H3.1 /// microcosm // W03A3.2 // polq-1 /// microcosm // W03F11.4 // W03F11.4 /// microcosm // W03F11.6a // afd-1 /// microcosm // W03F11.6b // afd-1 /// microcosm // W03F8.2 // W03F8.2 /// microcosm // W03G9.3 // W03G9.3 /// microcosm // W04D2.6b // W04D2.6 /// microcosm // W06H8.1b // rme-1 /// microcosm // W06H8.1c // rme-1 /// microcosm // W06H8.1d // rme-1 /// microcosm // W06H8.1f.4 // rme-1 /// microcosm // W07G1.3 // zip-3 /// microcosm // W08D2.3b // W08D2.3 /// microcosm // W09C5.4 // ins-33 /// microcosm // W09C5.7 // W09C5.7 /// microcosm // W09G3.6 // W09G3.6 /// microcosm // W10D5.2.1 // W10D5.2 /// microcosm // Y106G6E.6.2 // csnk-1 /// microcosm // Y106G6H.5.1 // Y106G6H.5 /// microcosm // Y110A2AL.5 // Y110A2AL.5 /// microcosm // Y116A8C.19 // Y116A8C.19 /// microcosm // Y11D7A.12 // Y11D7A.12 /// microcosm // Y16E11A.2 // Y16E11A.2 /// microcosm // Y17G9B.1 // Y17G9B.1 /// microcosm // Y2C2A.1 // tag-80 /// microcosm // Y32B12A.5 // Y32B12A.5 /// microcosm // Y32H12A.1 // Y32H12A.1 /// microcosm // Y32H12A.7.3 // Y32H12A.7 /// microcosm // Y37F4.8 // Y37F4.8 /// microcosm // Y38C1AA.1c // Y38C1AA.1 /// microcosm // Y38C1AA.7 // Y38C1AA.7 /// microcosm // Y38E10A.28 // Y38E10A.28 /// microcosm // Y38F2AR.3 // Y38F2AR.3 /// microcosm // Y38H6C.19 // Y38H6C.19 /// microcosm // Y38H8A.3 // Y38H8A.3 /// microcosm // Y39B6A.46 // Y39B6A.46 /// microcosm // Y39G10AR.6 // ugt-31 /// microcosm // Y41C4A.8 // Y41C4A.8 /// microcosm // Y41G9A.4b // Y41G9A.4 /// microcosm // Y46B2A.2 // Y46B2A.2 /// microcosm // Y47D3A.26 // smc-3 /// microcosm // Y47D7A.3 // Y47D7A.3 /// microcosm // Y47D9A.1a.1 // Y47D9A.1 /// microcosm // Y47D9A.1b // Y47D9A.1 /// microcosm // Y48G1BL.2 // atm-1 /// microcosm // Y48G1BM.2 // Y48G1BM.2 /// microcosm // Y48G1C.6 // Y48G1C.6 /// microcosm // Y51H4A.17 // sta-1 /// microcosm // Y54C5A.1 // Y54C5A.1 /// microcosm // Y54E2A.12 // Y54E2A.12 /// microcosm // Y54G2A.5a.1 // Y54G2A.5 /// microcosm // Y56A3A.36 // Y56A3A.36 /// microcosm // Y57A10B.1 // Y57A10B.1 /// microcosm // Y57G11C.24a.1 // eps-8 /// microcosm // Y57G11C.24g // eps-8 /// microcosm // Y59E1A.1 // fbxa-40 /// microcosm // Y59E1B.2 // Y59E1B.2 /// microcosm // Y61A9LA.1 // Y61A9LA.1 /// microcosm // Y61A9LA.3a // Y61A9LA.3 /// microcosm // Y61A9LA.3c // Y61A9LA.3 /// microcosm // Y62E10A.4 // srsx-25 /// microcosm // Y65A5A.3 // Y65A5A.3 /// microcosm // Y66H1B.3.2 // Y66H1B.3 /// microcosm // Y69A2AR.13 // Y69A2AR.13 /// microcosm // Y6G8.3 // Y6G8.3 /// microcosm // Y6G8.6 // Y6G8.6 /// microcosm // Y71F9AM.4b // cogc-3 /// microcosm // Y71H9A.3.1 // sto-4 /// microcosm // Y73B3A.1 // Y73B3A.1 /// microcosm // Y73B6BL.22 // Y73B6BL.22 /// microcosm // Y73F8A.36 // Y73F8A.36 /// microcosm // Y73F8A.9 // pqn-91 /// microcosm // Y75B8A.11 // Y75B8A.11 /// microcosm // Y75B8A.4.2 // Y75B8A.4 /// microcosm // Y81B9A.3 // Y81B9A.3 /// microcosm // ZC168.2 // ZC168.2 /// microcosm // ZC239.2 // ZC239.2 /// microcosm // ZC239.9 // sri-48 /// microcosm // ZC266.1 // ZC266.1 /// microcosm // ZC266.2 // ZC266.2 /// microcosm // ZC395.3b // toc-1 /// microcosm // ZC416.1 // ZC416.1 /// microcosm // ZK1005.1a // pme-5 /// microcosm // ZK1005.1b // pme-5 /// microcosm // ZK1128.3 // ZK1128.3 /// microcosm // ZK1193.5a // ZK1193.5 /// microcosm // ZK1307.6 // fzr-1 /// microcosm // ZK1321.1 // ZK1321.1 /// microcosm // ZK177.8a // ZK177.8 /// microcosm // ZK177.8b.2 // ZK177.8 /// microcosm // ZK250.9 // ZK250.9 /// microcosm // ZK328.7b // ZK328.7 /// microcosm // ZK742.4 // ZK742.4 /// microcosm // ZK856.11 // ZK856.11 /// microcosm // ZK909.4 // ces-2 /// microcosm // ZK994.3 // pxn-1 miRNA-4_0 May 13, 2014 miRBase cel-let-7-5p
MIMAT0015091_st 20500001 MIMAT0015091 cel-let-7-3p miRNA Caenorhabditis elegans X:14744123-14744147 (-) 25 UGAACUAUGCAAUUUUCUACCUUAC C05G5.6 // sense // exon // 1 --- --- miRNA-4_0 May 13, 2014 miRBase cel-let-7-3p
MIMAT0000002_st 20500002 MIMAT0000002 cel-lin-4-5p miRNA Caenorhabditis elegans II:5902246-5902266 (+) 21 UCCCUGAGACCUCAAGUGUGA F59G1.10 // antisense // exon // 1 /// F59G1.4 // sense // intron // 9 /// F59G1.6 // sense // exon // 1 --- MTI // --- // Y50D7A.18 /// microcosm // AC7.3 // AC7.3 /// microcosm // B0024.15 // B0024.15 /// microcosm // B0025.2.4 // csn-2 /// microcosm // B0212.1 // B0212.1 /// microcosm // B0212.2 // sre-5 /// microcosm // B0250.10 // srbc-78 /// microcosm // B0273.1 // B0273.1 /// microcosm // B0281.5 // B0281.5 /// microcosm // B0286.1 // B0286.1 /// microcosm // B0334.13 // B0334.13 /// microcosm // B0365.7 // B0365.7 /// microcosm // B0379.2 // B0379.2 /// microcosm // B0391.10 // B0391.10 /// microcosm // B0391.5 // B0391.5 /// microcosm // B0416.6 // gly-13 /// microcosm // B0432.10 // B0432.10 /// microcosm // B0432.14 // B0432.14 /// microcosm // B0513.6 // B0513.6 /// microcosm // B0564.4 // B0564.4 /// microcosm // C01A2.6 // C01A2.6 /// microcosm // C01G6.2 // C01G6.2 /// microcosm // C01G8.2.2 // cln-3.2 /// microcosm // C02E7.2 // srh-21 /// microcosm // C02G6.3 // C02G6.3 /// microcosm // C04E6.4 // C04E6.4 /// microcosm // C05C12.1 // C05C12.1 /// microcosm // C05E11.6 // C05E11.6 /// microcosm // C05E4.14b // srh-2 /// microcosm // C05E4.3 // srp-1 /// microcosm // C06A5.3a // C06A5.3 /// microcosm // C06E7.2.2 // C06E7.2 /// microcosm // C06G3.11a // tin-9.1 /// microcosm // C06G3.4 // C06G3.4 /// microcosm // C06G3.7 // trxr-1 /// microcosm // C07A9.9 // C07A9.9 /// microcosm // C08C3.4b // C08C3.4 /// microcosm // C08E3.13 // C08E3.13 /// microcosm // C08E8.6 // C08E8.6 /// microcosm // C08G9.1 // C08G9.1 /// microcosm // C09G12.5 // C09G12.5 /// microcosm // C10H11.9 // let-502 /// microcosm // C11H1.2 // C11H1.2 /// microcosm // C12C8.3a // lin-41 /// microcosm // C14A4.3 // C14A4.3 /// microcosm // C14E2.4 // C14E2.4 /// microcosm // C14E2.7 // C14E2.7 /// microcosm // C15H11.10 // C15H11.10 /// microcosm // C16C10.10 // tag-73 /// microcosm // C16C8.7 // C16C8.7 /// microcosm // C16C8.8 // C16C8.8 /// microcosm // C16D6.2 // C16D6.2 /// microcosm // C17D12.7 // C17D12.7 /// microcosm // C17F4.12 // C17F4.12 /// microcosm // C17F4.5 // C17F4.5 /// microcosm // C17H1.4 // C17H1.4 /// microcosm // C18A3.8 // hlh-14 /// microcosm // C18C4.9 // C18C4.9 /// microcosm // C18D11.9 // C18D11.9 /// microcosm // C18D4.1 // C18D4.1 /// microcosm // C18E3.2.2 // C18E3.2 /// microcosm // C18H9.5 // C18H9.5 /// microcosm // C24A11.6 // C24A11.6 /// microcosm // C24H12.4a // C24H12.4 /// microcosm // C25D7.12 // C25D7.12 /// microcosm // C25H3.6c // C25H3.6 /// microcosm // C26B2.5 // C26B2.5 /// microcosm // C26D10.6a.2 // C26D10.6 /// microcosm // C27H6.3 // C27H6.3 /// microcosm // C28D4.4 // C28D4.4 /// microcosm // C29F5.4b // mps-1 /// microcosm // C30A5.5 // snb-5 /// microcosm // C30D11.1 // unc-103 /// microcosm // C30F12.1 // C30F12.1 /// microcosm // C30F12.5 // C30F12.5 /// microcosm // C31B8.6 // str-46 /// microcosm // C31E10.2 // C31E10.2 /// microcosm // C32B5.5 // C32B5.5 /// microcosm // C33C12.7 // C33C12.7 /// microcosm // C33D9.5 // C33D9.5 /// microcosm // C33H5.16 // C33H5.16 /// microcosm // C33H5.8 // C33H5.8 /// microcosm // C34E7.3 // C34E7.3 /// microcosm // C35E7.4 // C35E7.4 /// microcosm // C37H5.11 // cwp-2 /// microcosm // C37H5.6a // C37H5.6 /// microcosm // C37H5.6b.1 // C37H5.6 /// microcosm // C38C10.6 // C38C10.6 /// microcosm // C41G11.4a // C41G11.4 /// microcosm // C41G11.4b // C41G11.4 /// microcosm // C41G6.6 // C41G6.6 /// microcosm // C41H7.9 // C41H7.9 /// microcosm // C42C1.6 // C42C1.6 /// microcosm // C44B12.8 // srx-14 /// microcosm // C44B12.9 // C44B12.9 /// microcosm // C44C3.6 // srw-117 /// microcosm // C45B11.2 // C45B11.2 /// microcosm // C45H4.10 // srbc-24 /// microcosm // C47F8.7 // C47F8.7 /// microcosm // C49A1.9 // C49A1.9 /// microcosm // C50C10.6 // str-193 /// microcosm // C50F2.9 // abf-1 /// microcosm // C50F4.9 // C50F4.9 /// microcosm // C50F7.4 // C50F7.4 /// microcosm // C50H11.4 // srt-7 /// microcosm // C52E2.8 // C52E2.8 /// microcosm // C53A5.6 // C53A5.6 /// microcosm // C53B4.7a.1 // bre-1 /// microcosm // C53B4.7c.2 // bre-1 /// microcosm // C53B7.6 // C53B7.6 /// microcosm // C53D6.11 // C53D6.11 /// microcosm // C53D6.3 // C53D6.3 /// microcosm // C54D1.5 // lam-2 /// microcosm // C54E4.1 // C54E4.1 /// microcosm // C54G4.6 // dod-18 /// microcosm // C54G7.2.1 // C54G7.2 /// microcosm // C54G7.2.2 // C54G7.2 /// microcosm // C54H2.1a // sym-3 /// microcosm // C55B7.11 // C55B7.11 /// microcosm // C56C10.8.1 // icd-1 /// microcosm // D1005.4 // D1005.4 /// microcosm // D1009.3a // D1009.3 /// microcosm // D1009.3b // D1009.3 /// microcosm // D1086.4 // D1086.4 /// microcosm // E03H4.10 // clec-17 /// microcosm // EEED8.16 // EEED8.16 /// microcosm // EEED8.6 // EEED8.6 /// microcosm // F01G10.7 // F01G10.7 /// microcosm // F02D8.4.2 // F02D8.4 /// microcosm // F02E9.2a // lin-28 /// microcosm // F02H6.6 // F02H6.6 /// microcosm // F07C3.10 // nhr-36 /// microcosm // F10A3.9 // str-254 /// microcosm // F10D7.1 // F10D7.1 /// microcosm // F10D7.4 // F10D7.4 /// microcosm // F10D7.5b // F10D7.5 /// microcosm // F10E9.2 // F10E9.2 /// microcosm // F11A5.12 // stdh-2 /// microcosm // F11A5.8 // F11A5.8 /// microcosm // F11F1.2 // F11F1.2 /// microcosm // F11H8.1.1 // rfl-1 /// microcosm // F13A2.5 // F13A2.5 /// microcosm // F13G11.1a // dmd-6 /// microcosm // F13G11.1b.1 // dmd-6 /// microcosm // F14B6.4 // F14B6.4 /// microcosm // F15A2.1 // col-184 /// microcosm // F15H10.2 // col-13 /// microcosm // F15H9.4 // sri-16 /// microcosm // F16A11.3b // F16A11.3 /// microcosm // F16C3.3 // F16C3.3 /// microcosm // F16H9.1b // rgs-2 /// microcosm // F17A9.1 // F17A9.1 /// microcosm // F17C8.2 // col-89 /// microcosm // F17E9.11 // lys-10 /// microcosm // F18E3.7a // F18E3.7 /// microcosm // F20C5.2b // klp-11 /// microcosm // F20C5.6 // F20C5.6 /// microcosm // F21C3.5 // pfd-6 /// microcosm // F21E9.3 // F21E9.3 /// microcosm // F21H12.3 // F21H12.3 /// microcosm // F21H7.2.2 // F21H7.2 /// microcosm // F22A3.7 // F22A3.7 /// microcosm // F22D6.11 // gly-18 /// microcosm // F22E5.2 // F22E5.2 /// microcosm // F26A3.7 // F26A3.7 /// microcosm // F26D10.9.2 // atg-1 /// microcosm // F26D11.9 // F26D11.9 /// microcosm // F27B10.1.1 // F27B10.1 /// microcosm // F27B10.1.2 // F27B10.1 /// microcosm // F27C8.1 // aat-1 /// microcosm // F28A10.3 // F28A10.3 /// microcosm // F29A7.5 // F29A7.5 /// microcosm // F30B5.4.2 // F30B5.4 /// microcosm // F30F8.3 // F30F8.3 /// microcosm // F31B9.3 // F31B9.3 /// microcosm // F31B9.4 // F31B9.4 /// microcosm // F31C3.5 // F31C3.5 /// microcosm // F31D5.5 // F31D5.5 /// microcosm // F31E9.3 // F31E9.3 /// microcosm // F31F4.1 // F31F4.1 /// microcosm // F32A7.3a // tag-271 /// microcosm // F32A7.3b // tag-271 /// microcosm // F32H2.11 // F32H2.11 /// microcosm // F32H5.3a // F32H5.3 /// microcosm // F32H5.3b // F32H5.3 /// microcosm // F33C8.2 // F33C8.2 /// microcosm // F33C8.3 // tsp-8 /// microcosm // F33D4.6a // F33D4.6 /// microcosm // F34D6.5 // sri-62 /// microcosm // F35C5.4 // F35C5.4 /// microcosm // F35D11.10 // F35D11.10 /// microcosm // F35D11.3.1 // F35D11.3 /// microcosm // F35D11.3.2 // F35D11.3 /// microcosm // F35E12.7d // F35E12.7 /// microcosm // F36A2.3 // F36A2.3 /// microcosm // F36D1.5 // F36D1.5 /// microcosm // F36D1.6 // F36D1.6 /// microcosm // F37C4.8 // F37C4.8 /// microcosm // F38B7.1b // F38B7.1 /// microcosm // F39E9.7 // F39E9.7 /// microcosm // F40E12.2 // F40E12.2 /// microcosm // F40G12.4 // F40G12.4 /// microcosm // F41B5.10 // nhr-183 /// microcosm // F41D3.7 // F41D3.7 /// microcosm // F41D9.3e // wrk-1 /// microcosm // F41G3.11 // srx-95 /// microcosm // F41H8.1 // F41H8.1 /// microcosm // F42A9.3 // F42A9.3 /// microcosm // F42A9.7 // F42A9.7 /// microcosm // F43A11.6 // srx-82 /// microcosm // F43C11.7 // F43C11.7 /// microcosm // F43D2.2 // F43D2.2 /// microcosm // F43D9.1 // F43D9.1 /// microcosm // F43G6.2 // F43G6.2 /// microcosm // F43G9.13.2 // F43G9.13 /// microcosm // F45C12.2 // F45C12.2 /// microcosm // F45C12.6 // F45C12.6 /// microcosm // F45E1.2 // F45E1.2 /// microcosm // F45E1.4 // F45E1.4 /// microcosm // F45E4.3a // F45E4.3 /// microcosm // F45H7.6 // F45H7.6 /// microcosm // F46A8.3 // F46A8.3 /// microcosm // F46A8.4 // F46A8.4 /// microcosm // F46B6.11 // sru-39 /// microcosm // F46F11.3 // tag-83 /// microcosm // F47B7.6 // F47B7.6 /// microcosm // F47D12.5 // F47D12.5 /// microcosm // F47D2.7 // srt-20 /// microcosm // F47F6.9 // F47F6.9 /// microcosm // F48C1.1 // F48C1.1 /// microcosm // F48G7.4 // F48G7.4 /// microcosm // F49H12.1b.2 // lsy-2 /// microcosm // F49H6.3 // F49H6.3 /// microcosm // F52D10.3b.2 // ftt-2 /// microcosm // F52E1.4a // gcy-7 /// microcosm // F53B7.2 // F53B7.2 /// microcosm // F53F1.1 // F53F1.1 /// microcosm // F53F10.1 // F53F10.1 /// microcosm // F54C1.2.1 // dom-3 /// microcosm // F54C9.6b.1 // F54C9.6 /// microcosm // F54D8.4 // cah-1 /// microcosm // F55A4.1.2 // F55A4.1 /// microcosm // F56A11.4 // F56A11.4 /// microcosm // F56A12.2 // F56A12.2 /// microcosm // F56D6.12 // F56D6.12 /// microcosm // F56H9.4 // gpa-9 /// microcosm // F56H9.6 // F56H9.6 /// microcosm // F57G8.3 // srh-167 /// microcosm // F57H12.5 // F57H12.5 /// microcosm // F58A3.1b // ldb-1 /// microcosm // F58D2.1 // F58D2.1 /// microcosm // F58E6.1b // F58E6.1 /// microcosm // F58F6.3 // F58F6.3 /// microcosm // F58G6.5a // nhr-34 /// microcosm // F58G6.5b // nhr-34 /// microcosm // F58G6.5c // nhr-34 /// microcosm // F59A6.3 // F59A6.3 /// microcosm // F59A6.6a // rnh-1.0 /// microcosm // F59E12.6b // F59E12.6 /// microcosm // F59E12.9 // F59E12.9 /// microcosm // H02I12.2 // fbxb-76 /// microcosm // H02I12.3 // tag-89 /// microcosm // H06H21.9 // H06H21.9 /// microcosm // H14A12.6 // H14A12.6 /// microcosm // H20J18.1a // scd-1 /// microcosm // H20J18.1b // scd-1 /// microcosm // H23N18.4 // H23N18.4 /// microcosm // H32C10.1 // H32C10.1 /// microcosm // H43I07.1 // H43I07.1 /// microcosm // H43I07.3 // H43I07.3 /// microcosm // K01D12.7 // K01D12.7 /// microcosm // K03B4.1 // K03B4.1 /// microcosm // K03B4.5 // srx-77 /// microcosm // K03D7.2 // srw-31 /// microcosm // K03H6.5 // K03H6.5 /// microcosm // K04C1.6 // srg-36 /// microcosm // K04D7.5 // gon-4 /// microcosm // K04F1.15 // alh-2 /// microcosm // K04F1.7 // K04F1.7 /// microcosm // K04F10.4b.1 // bli-4 /// microcosm // K04G11.4 // K04G11.4 /// microcosm // K05B2.5a.2 // pes-22 /// microcosm // K05C4.10 // K05C4.10 /// microcosm // K05D4.6 // srh-277 /// microcosm // K07A1.7 // K07A1.7 /// microcosm // K07C6.7 // srx-64 /// microcosm // K07E8.7 // K07E8.7 /// microcosm // K08A2.5b.2 // nhr-88 /// microcosm // K08D10.5 // K08D10.5 /// microcosm // K08H10.1.2 // lea-1 /// microcosm // K09E4.2 // K09E4.2 /// microcosm // K10H10.7 // K10H10.7 /// microcosm // K11D2.1 // K11D2.1 /// microcosm // K12H6.4 // K12H6.4 /// microcosm // M01E5.1 // M01E5.1 /// microcosm // M01F1.3.3 // M01F1.3 /// microcosm // M01F1.7 // M01F1.7 /// microcosm // M01G5.6 // M01G5.6 /// microcosm // M03C11.6 // M03C11.6 /// microcosm // M03F4.4 // M03F4.4 /// microcosm // M162.2 // M162.2 /// microcosm // M7.10 // M7.10 /// miRecords // NM_001025914 // lin-28 /// miRecords // NM_001047778 // hbl-1 /// miRecords // NM_077516 // lin-14 /// microcosm // R03D7.6 // gst-5 /// microcosm // R06A4.6 // sdz-26 /// microcosm // R06B10.2 // R06B10.2 /// microcosm // R07C12.1 // R07C12.1 /// microcosm // R07E5.4 // R07E5.4 /// microcosm // R08B4.1b // grd-1 /// microcosm // R08E3.2 // R08E3.2 /// microcosm // R09F10.6 // srh-11 /// microcosm // R10D12.8 // R10D12.8 /// microcosm // R10E11.7 // srxa-10 /// microcosm // R11A5.2 // nud-2 /// microcosm // R11G1.7 // R11G1.7 /// microcosm // R12A1.3 // R12A1.3 /// microcosm // R12E2.4b // inx-17 /// microcosm // R134.2 // gcy-2 /// microcosm // R13A1.1 // R13A1.1 /// microcosm // R13D11.9 // srx-32 /// microcosm // R144.2b // R144.2 /// microcosm // R144.7a // larp-1 /// microcosm // R17.2 // R17.2 /// microcosm // R173.1 // cah-5 /// microcosm // R186.7 // R186.7 /// microcosm // T01D1.2c.2 // etr-1 /// microcosm // T02B11.5 // srj-38 /// microcosm // T02C12.4 // T02C12.4 /// microcosm // T02E9.5.1 // T02E9.5 /// microcosm // T02G5.3 // T02G5.3 /// microcosm // T02H6.3 // T02H6.3 /// microcosm // T03F7.6 // T03F7.6 /// microcosm // T04D3.4 // gcy-35 /// microcosm // T05A10.5.1 // T05A10.5 /// microcosm // T05A7.11 // T05A7.11 /// microcosm // T05E7.1 // T05E7.1 /// microcosm // T05E8.1 // T05E8.1 /// microcosm // T05H10.1 // T05H10.1 /// microcosm // T06A4.2 // mps-3 /// microcosm // T07A5.4 // T07A5.4 /// microcosm // T07C4.3a // T07C4.3 /// microcosm // T07C4.3b // T07C4.3 /// microcosm // T07C5.1b // ugt-50 /// microcosm // T07D3.4 // T07D3.4 /// microcosm // T07H6.2 // mom-1 /// microcosm // T08E11.6 // fbxb-10 /// microcosm // T08H10.3 // T08H10.3 /// microcosm // T08H10.4 // T08H10.4 /// microcosm // T09A5.3 // acr-7 /// microcosm // T09E11.7 // T09E11.7 /// microcosm // T09F3.1 // T09F3.1 /// microcosm // T10A3.1a // unc-10 /// microcosm // T10D4.5 // srh-71 /// microcosm // T10D4.8 // sri-54 /// microcosm // T10E9.6 // T10E9.6 /// microcosm // T11B7.3 // col-118 /// microcosm // T11F9.10 // T11F9.10 /// microcosm // T11F9.14 // T11F9.14 /// microcosm // T12A2.12 // srg-4 /// microcosm // T12B5.13 // fbxa-23 /// microcosm // T12G3.5.1 // T12G3.5 /// microcosm // T14B4.5 // T14B4.5 /// microcosm // T14F9.4b // peb-1 /// microcosm // T15D6.9 // T15D6.9 /// microcosm // T19C9.3 // srh-252 /// microcosm // T19D12.2c.1 // T19D12.2 /// microcosm // T19D2.1 // T19D2.1 /// microcosm // T19D7.3 // T19D7.3 /// microcosm // T19E7.3.1 // bec-1 /// microcosm // T19E7.3.2 // bec-1 /// microcosm // T19H12.7 // str-32 /// microcosm // T20B3.12 // clec-26 /// microcosm // T20G5.2.2 // cts-1 /// microcosm // T22C1.7 // jph-1 /// microcosm // T22E5.6 // T22E5.6 /// microcosm // T23B12.8 // T23B12.8 /// microcosm // T23B5.3b // T23B5.3 /// microcosm // T23C6.3.1 // T23C6.3 /// microcosm // T23C6.3.2 // T23C6.3 /// microcosm // T23G4.2 // T23G4.2 /// microcosm // T23H2.1 // npp-12 /// microcosm // T24A6.19 // grl-31 /// microcosm // T24C12.1 // T24C12.1 /// microcosm // T24D8.6 // T24D8.6 /// microcosm // T24H10.7b // T24H10.7 /// microcosm // T24H10.7c // T24H10.7 /// microcosm // T24H7.4 // T24H7.4 /// microcosm // T25B2.2b // T25B2.2 /// microcosm // T25E12.4b // T25E12.4 /// microcosm // T25E12.8 // clec-34 /// microcosm // T25F10.1 // T25F10.1 /// microcosm // T25G12.8 // T25G12.8 /// microcosm // T26E3.1 // T26E3.1 /// microcosm // T26E4.15 // srsx-36 /// microcosm // T27A1.5b.1 // T27A1.5 /// microcosm // T27C5.10 // T27C5.10 /// microcosm // T27E7.4 // T27E7.4 /// microcosm // T28C6.5 // T28C6.5 /// microcosm // T28H11.5 // ssq-2 /// microcosm // W01A8.6 // W01A8.6 /// microcosm // W01B6.4 // W01B6.4 /// microcosm // W01D2.6 // W01D2.6 /// microcosm // W02B12.4 // W02B12.4 /// microcosm // W02C12.3d.1 // hlh-30 /// microcosm // W02C12.3g.1 // hlh-30 /// microcosm // W02C12.3h.6 // hlh-30 /// microcosm // W02D7.4 // W02D7.4 /// microcosm // W02D9.3 // W02D9.3 /// microcosm // W02D9.9 // W02D9.9 /// microcosm // W02F12.4a // W02F12.4 /// microcosm // W04E12.9 // W04E12.9 /// microcosm // W07B8.5 // cpr-5 /// microcosm // W09C3.2 // W09C3.2 /// microcosm // W10D9.1 // W10D9.1 /// microcosm // Y102E9.3 // Y102E9.3 /// microcosm // Y108F1.4 // math-43 /// microcosm // Y110A7A.7 // Y110A7A.7 /// microcosm // Y113G7A.1 // srh-233 /// microcosm // Y116A8C.29 // Y116A8C.29 /// microcosm // Y119C1B.1 // Y119C1B.1 /// microcosm // Y18D10A.1 // Y18D10A.1 /// microcosm // Y18D10A.18 // fbxa-121 /// microcosm // Y18D10A.7b.1 // ptr-17 /// microcosm // Y18D10A.7b.2 // ptr-17 /// microcosm // Y18D10A.9 // Y18D10A.9 /// microcosm // Y22D7AR.5 // Y22D7AR.5 /// microcosm // Y23H5A.8 // Y23H5A.8 /// microcosm // Y26D4A.6 // Y26D4A.6 /// microcosm // Y27F2A.4 // sri-33 /// microcosm // Y27F2A.5 // Y27F2A.5 /// microcosm // Y27F2A.9 // Y27F2A.9 /// microcosm // Y37A1B.10 // srw-63 /// microcosm // Y37A1B.15 // gei-18 /// microcosm // Y37A1C.1b // Y37A1C.1 /// microcosm // Y37D8A.8 // Y37D8A.8 /// microcosm // Y37E11AM.1 // Y37E11AM.1 /// microcosm // Y39A1A.11 // dhs-11 /// microcosm // Y39A1A.13 // Y39A1A.13 /// microcosm // Y39A1A.2 // Y39A1A.2 /// microcosm // Y39G10AR.12a // tpxl-1 /// microcosm // Y41C4A.5 // pqn-84 /// microcosm // Y41D4B.20 // nhr-287 /// microcosm // Y41D4B.5.1 // rps-28 /// microcosm // Y41D4B.9 // nhr-122 /// microcosm // Y41E3.11 // Y41E3.11 /// microcosm // Y41G9A.3 // Y41G9A.3 /// microcosm // Y43F8C.19 // srv-3 /// microcosm // Y45F10B.6 // sru-11 /// microcosm // Y45G12C.14 // srj-19 /// microcosm // Y46D2A.1 // Y46D2A.1 /// microcosm // Y46E12BL.4 // Y46E12BL.4 /// microcosm // Y47D7A.1.2 // skr-7 /// microcosm // Y47G6A.26 // Y47G6A.26 /// microcosm // Y47H9C.8 // Y47H9C.8 /// microcosm // Y47H9C.9 // Y47H9C.9 /// microcosm // Y48A6C.3 // Y48A6C.3 /// microcosm // Y48A6C.4 // Y48A6C.4 /// microcosm // Y48B6A.8 // ace-3 /// microcosm // Y48E1B.2b // Y48E1B.2 /// microcosm // Y48E1B.9.2 // Y48E1B.9 /// microcosm // Y48G1BM.1 // Y48G1BM.1 /// microcosm // Y48G8AR.3 // Y48G8AR.3 /// microcosm // Y49F6C.6 // Y49F6C.6 /// microcosm // Y4C6B.4b // Y4C6B.4 /// microcosm // Y53C10A.9 // abt-5 /// microcosm // Y53C12A.4.2 // Y53C12A.4 /// microcosm // Y54E5B.3a // let-49 /// microcosm // Y56A3A.32.1 // wah-1 /// microcosm // Y56A3A.32.2 // wah-1 /// microcosm // Y57A10C.9 // Y57A10C.9 /// microcosm // Y57G11C.9b.1 // Y57G11C.9 /// microcosm // Y57G11C.9b.2 // Y57G11C.9 /// microcosm // Y57G7A.12 // srz-63 /// microcosm // Y59C2A.1 // Y59C2A.1 /// microcosm // Y65B4BR.3 // ptr-21 /// microcosm // Y65B4BR.6a // grl-16 /// microcosm // Y65B4BR.6b // grl-16 /// microcosm // Y66C5A.2 // Y66C5A.2 /// microcosm // Y69H2.14.1 // Y69H2.14 /// microcosm // Y71A12B.1.2 // rps-6 /// microcosm // Y71D11A.2a.2 // smr-1 /// microcosm // Y71F9AL.18.1 // pme-1 /// microcosm // Y71G12B.17 // Y71G12B.17 /// microcosm // Y71G12B.1a // Y71G12B.1 /// microcosm // Y71H2AM.14 // Y71H2AM.14 /// microcosm // Y71H2AM.2 // Y71H2AM.2 /// microcosm // Y71H2AM.20a.2 // Y71H2AM.20 /// microcosm // Y75B7B.1 // Y75B7B.1 /// microcosm // Y75B8A.34 // Y75B8A.34 /// microcosm // Y75B8A.37 // Y75B8A.37 /// microcosm // Y76B12C.1 // Y76B12C.1 /// microcosm // Y77E11A.10 // clp-6 /// microcosm // Y77E11A.14 // Y77E11A.14 /// microcosm // Y77E11A.8 // Y77E11A.8 /// microcosm // Y80D3A.8 // Y80D3A.8 /// microcosm // Y82E9BR.8 // Y82E9BR.8 /// microcosm // Y87G2A.10.2 // Y87G2A.10 /// microcosm // Y92H12BL.2 // Y92H12BL.2 /// microcosm // Y92H12BR.4 // Y92H12BR.4 /// microcosm // Y94H6A.11 // Y94H6A.11 /// microcosm // Y97E10AR.1 // Y97E10AR.1 /// microcosm // ZC168.2 // ZC168.2 /// microcosm // ZC404.11 // ZC404.11 /// microcosm // ZC410.2.2 // mppb-1 /// microcosm // ZC434.2.2 // rps-7 /// microcosm // ZC443.2 // ZC443.2 /// microcosm // ZK1025.4a // ZK1025.4 /// microcosm // ZK1053.2 // ZK1053.2 /// microcosm // ZK1098.11 // ZK1098.11 /// microcosm // ZK1128.3 // ZK1128.3 /// microcosm // ZK1248.20 // ZK1248.20 /// microcosm // ZK1251.11 // ins-8 /// microcosm // ZK177.11 // ZK177.11 /// microcosm // ZK218.7 // ZK218.7 /// microcosm // ZK287.7 // ZK287.7 /// microcosm // ZK355.1 // ZK355.1 /// microcosm // ZK470.2b.2 // ZK470.2 /// microcosm // ZK643.6 // ZK643.6 /// microcosm // ZK721.4.1 // ZK721.4 /// microcosm // ZK742.3 // ZK742.3 /// microcosm // ZK757.3c // tag-76 /// microcosm // ZK783.1 // fbn-1 /// microcosm // ZK809.3.2 // ZK809.3 /// microcosm // ZK849.1 // ZK849.1 /// microcosm // ZK849.2b // ZK849.2 /// microcosm // ZK863.5 // srd-4 /// microcosm // ZK863.8 // ZK863.8 /// microcosm // ZK892.1c // lec-3 miRNA-4_0 May 13, 2014 miRBase cel-lin-4-5p
MIMAT0015092_st 20500003 MIMAT0015092 cel-lin-4-3p miRNA Caenorhabditis elegans II:5902285-5902305 (+) 21 ACACCUGGGCUCUCCGGGUAC F59G1.10 // antisense // exon // 1 /// F59G1.4 // sense // intron // 9 /// F59G1.6 // sense // exon // 1 --- --- miRNA-4_0 May 13, 2014 miRBase cel-lin-4-3p
MIMAT0020301_st 20500004 MIMAT0020301 cel-miR-1-5p miRNA Caenorhabditis elegans I:6172718-6172739 (-) 22 CAUACUUCCUUACAUGCCCAUA T09B4.11 // sense // exon // 1 /// T09B4.14 // antisense // exon // 1 --- --- miRNA-4_0 May 13, 2014 miRBase cel-miR-1-5p
MIMAT0000003_st 20500005 MIMAT0000003 cel-miR-1-3p miRNA Caenorhabditis elegans I:6172679-6172699 (-) 21 UGGAAUGUAAAGAAGUAUGUA T09B4.11 // sense // exon // 1 /// T09B4.14 // antisense // exon // 1 --- MTI // --- // C45G7.12 /// microcosm // B0001.5 // B0001.5 /// microcosm // B0034.1 // B0034.1 /// microcosm // B0207.12a // avr-14 /// microcosm // B0207.3b // gpa-14 /// microcosm // B0250.8 // B0250.8 /// microcosm // B0281.5 // B0281.5 /// microcosm // B0294.1 // B0294.1 /// microcosm // B0334.4 // B0334.4 /// microcosm // B0334.8 // age-1 /// microcosm // B0336.1.2 // wrm-1 /// microcosm // B0348.4a // egl-8 /// microcosm // B0348.4b // egl-8 /// microcosm // B0350.2f.2 // unc-44 /// microcosm // B0416.6 // gly-13 /// microcosm // B0457.4 // B0457.4 /// microcosm // B0495.7.1 // B0495.7 /// microcosm // B0495.7.2 // B0495.7 /// microcosm // B0507.2 // B0507.2 /// microcosm // B0507.6 // B0507.6 /// microcosm // B0511.2 // B0511.2 /// microcosm // C01B12.2 // C01B12.2 /// microcosm // C01B7.4 // tag-117 /// microcosm // C01C10.3 // acl-12 /// microcosm // C01G5.5 // C01G5.5 /// microcosm // C02H7.3a // aex-3 /// microcosm // C03B1.14 // C03B1.14 /// microcosm // C03B8.1 // C03B8.1 /// microcosm // C04A11.2 // C04A11.2 /// microcosm // C04F5.7 // ugt-63 /// microcosm // C05D9.9b // C05D9.9 /// microcosm // C05E7.1 // C05E7.1 /// microcosm // C06A8.9 // glr-4 /// microcosm // C06E1.4 // glr-1 /// microcosm // C06E7.6 // spe-27 /// microcosm // C08B6.4a // C08B6.4 /// microcosm // C08B6.4b // C08B6.4 /// microcosm // C08F11.3 // C08F11.3 /// microcosm // C09D4.4c // C09D4.4 /// microcosm // C09F5.1 // C09F5.1 /// microcosm // C10C6.6 // C10C6.6 /// microcosm // C11D2.6c // nca-1 /// microcosm // C11D2.6d // nca-1 /// microcosm // C11G6.3 // C11G6.3 /// microcosm // C11H1.4 // prx-1 /// microcosm // C12D5.2 // nhr-152 /// microcosm // C14F5.1b // C14F5.1 /// microcosm // C15F1.2 // C15F1.2 /// microcosm // C16A3.9.1 // rps-13 /// microcosm // C16C10.10 // tag-73 /// microcosm // C16C2.4 // C16C2.4 /// microcosm // C16D6.2 // C16D6.2 /// microcosm // C17G10.9a.1 // C17G10.9 /// microcosm // C17H12.9 // ceh-48 /// microcosm // C18E9.10 // C18E9.10 /// microcosm // C23F12.3 // C23F12.3 /// microcosm // C24A11.5 // C24A11.5 /// microcosm // C24B9.8 // str-13 /// microcosm // C24H12.11 // C24H12.11 /// microcosm // C25G4.10 // C25G4.10 /// microcosm // C25G4.11 // C25G4.11 /// microcosm // C25H3.7a // C25H3.7 /// microcosm // C25H3.7b // C25H3.7 /// microcosm // C27A12.6 // C27A12.6 /// microcosm // C27A7.9 // C27A7.9 /// microcosm // C27D8.3b // C27D8.3 /// microcosm // C27H5.3.1 // C27H5.3 /// microcosm // C27H5.3.2 // C27H5.3 /// microcosm // C27H5.3.3 // C27H5.3 /// microcosm // C28D4.2 // cka-1 /// microcosm // C28H8.9b // C28H8.9 /// microcosm // C29E4.2 // kle-2 /// microcosm // C29G2.5 // srt-58 /// microcosm // C30E1.5 // fbxb-114 /// microcosm // C30G12.6b // C30G12.6 /// microcosm // C31H2.1a // C31H2.1 /// microcosm // C31H2.1b // C31H2.1 /// microcosm // C32B5.15 // C32B5.15 /// microcosm // C32E8.10c // unc-11 /// microcosm // C32E8.10f // unc-11 /// microcosm // C32E8.4.1 // C32E8.4 /// microcosm // C33A12.6 // ugt-21 /// microcosm // C33D3.3 // C33D3.3 /// microcosm // C33D3.4 // C33D3.4 /// microcosm // C33E10.5 // C33E10.5 /// microcosm // C33G3.1b.2 // dyc-1 /// microcosm // C33G8.2 // C33G8.2 /// microcosm // C34B2.5 // C34B2.5 /// microcosm // C34C12.4.1 // C34C12.4 /// microcosm // C34E11.1.2 // rsd-3 /// microcosm // C34F6.7 // C34F6.7 /// microcosm // C34H4.1 // C34H4.1 /// microcosm // C35A5.1 // aqp-5 /// microcosm // C35A5.4 // C35A5.4 /// microcosm // C38D4.6b.2 // pal-1 /// microcosm // C38H2.2 // C38H2.2 /// microcosm // C40A11.7 // C40A11.7 /// microcosm // C41A3.2a // C41A3.2 /// microcosm // C41G7.2.1 // klp-16 /// microcosm // C41G7.2.2 // klp-16 /// microcosm // C43C3.1 // ifp-1 /// microcosm // C44H4.3 // sym-1 /// microcosm // C45B2.4a // ggr-2 /// microcosm // C45B2.6 // C45B2.6 /// microcosm // C45H4.13 // C45H4.13 /// microcosm // C46H11.4b // lfe-2 /// microcosm // C47B2.6b // C47B2.6 /// microcosm // C47E12.3 // C47E12.3 /// microcosm // C47F8.5 // C47F8.5 /// microcosm // C48B6.10 // C48B6.10 /// microcosm // C48B6.8 // C48B6.8 /// microcosm // C49F8.2 // C49F8.2 /// microcosm // C50H11.8 // C50H11.8 /// microcosm // C50H2.4 // C50H2.4 /// microcosm // C54D1.6.1 // bar-1 /// microcosm // C54D1.6.2 // bar-1 /// microcosm // C55A1.11 // C55A1.11 /// microcosm // C56C10.10 // C56C10.10 /// microcosm // C56E6.6 // C56E6.6 /// microcosm // CD4.9 // CD4.9 /// microcosm // D1005.6 // D1005.6 /// microcosm // D1025.4 // nspc-20 /// microcosm // D1054.5 // D1054.5 /// microcosm // D1073.1b // trk-1 /// microcosm // D2013.2 // wdfy-2 /// microcosm // D2021.2a // tag-233 /// microcosm // D2045.7 // D2045.7 /// microcosm // D2063.3a // D2063.3 /// microcosm // D2096.4.1 // sqv-1 /// microcosm // D2096.4.2 // sqv-1 /// microcosm // E01A2.6 // E01A2.6 /// microcosm // E01H11.1a.1 // pkc-2 /// microcosm // E01H11.1a.2 // pkc-2 /// microcosm // E01H11.1c // pkc-2 /// microcosm // E02H4.5 // E02H4.5 /// microcosm // EEED8.8 // ndx-6 /// microcosm // F01D5.1.1 // F01D5.1 /// microcosm // F01F1.8a.1 // cct-6 /// microcosm // F02A9.1 // F02A9.1 /// microcosm // F02E8.2a // F02E8.2 /// microcosm // F02E8.2b // F02E8.2 /// microcosm // F07E5.4 // F07E5.4 /// microcosm // F07G11.9 // F07G11.9 /// microcosm // F08G12.3 // F08G12.3 /// microcosm // F09E5.12 // F09E5.12 /// microcosm // F09E5.14 // F09E5.14 /// microcosm // F09E5.17 // bmy-1 /// microcosm // F09F7.5b // F09F7.5 /// microcosm // F09G2.4 // F09G2.4 /// microcosm // F10C1.7a // ifb-2 /// microcosm // F10C1.7c.1 // ifb-2 /// microcosm // F10C1.7c.2 // ifb-2 /// microcosm // F10C1.7c.3 // ifb-2 /// microcosm // F11A5.7 // F11A5.7 /// microcosm // F11A6.1b // kpc-1 /// microcosm // F11C3.1 // F11C3.1 /// microcosm // F13E6.3 // F13E6.3 /// microcosm // F13E9.4 // F13E9.4 /// microcosm // F13E9.6 // sdz-13 /// microcosm // F14D7.9 // F14D7.9 /// microcosm // F14F8.4 // srz-103 /// microcosm // F14H12.3 // F14H12.3 /// microcosm // F15H10.10 // F15H10.10 /// microcosm // F16B12.4 // F16B12.4 /// microcosm // F16B12.8 // nhr-281 /// microcosm // F16B3.3 // F16B3.3 /// microcosm // F16F9.4 // F16F9.4 /// microcosm // F17C11.1 // F17C11.1 /// microcosm // F19B6.1b // F19B6.1 /// microcosm // F20C5.1a.1 // pme-3 /// microcosm // F20C5.1c // pme-3 /// microcosm // F20D6.10 // F20D6.10 /// microcosm // F21A10.2a.4 // F21A10.2 /// microcosm // F21D12.3 // F21D12.3 /// microcosm // F21D5.5 // F21D5.5 /// microcosm // F21H11.2a // sax-2 /// microcosm // F21H7.1 // gst-22 /// microcosm // F22A3.1 // ets-4 /// microcosm // F22D6.1 // kin-14 /// microcosm // F22E12.1 // F22E12.1 /// microcosm // F22F4.5 // F22F4.5 /// microcosm // F22F7.2 // F22F7.2 /// microcosm // F22H10.6 // F22H10.6 /// microcosm // F23B2.12.1 // pcp-2 /// microcosm // F23H11.1 // bra-2 /// microcosm // F25B3.2 // F25B3.2 /// microcosm // F25E5.1 // F25E5.1 /// microcosm // F25H2.8.2 // ubc-25 /// microcosm // F25H5.7 // F25H5.7 /// microcosm // F28C10.4 // F28C10.4 /// microcosm // F28H1.4a // F28H1.4 /// microcosm // F29C12.3 // F29C12.3 /// microcosm // F29D10.3 // F29D10.3 /// microcosm // F31B9.3 // F31B9.3 /// microcosm // F31C3.4 // F31C3.4 /// microcosm // F31E3.3 // rfc-4 /// microcosm // F31E3.4 // F31E3.4 /// microcosm // F32A5.2b // F32A5.2 /// microcosm // F32D1.2.2 // F32D1.2 /// microcosm // F32H2.11 // F32H2.11 /// microcosm // F33C8.2 // F33C8.2 /// microcosm // F33D11.9a.1 // F33D11.9 /// microcosm // F33D11.9a.2 // F33D11.9 /// microcosm // F34D6.5 // sri-62 /// microcosm // F35A5.3 // abu-10 /// microcosm // F35D11.11d // F35D11.11 /// microcosm // F35D11.3.1 // F35D11.3 /// microcosm // F35D11.3.2 // F35D11.3 /// microcosm // F35H10.4.1 // vha-5 /// microcosm // F35H10.4.2 // vha-5 /// microcosm // F35H10.4.3 // vha-5 /// microcosm // F35H12.6 // F35H12.6 /// microcosm // F35H8.3 // zfp-2 /// microcosm // F36D1.4 // F36D1.4 /// microcosm // F38E1.7 // mom-2 /// microcosm // F38E9.1 // F38E9.1 /// microcosm // F39G3.5a // F39G3.5 /// microcosm // F40F12.3 // F40F12.3 /// microcosm // F40F8.9.1 // lsm-1 /// microcosm // F40H7.2 // srx-108 /// microcosm // F41E6.2 // grd-5 /// microcosm // F41E6.7 // F41E6.7 /// microcosm // F41E7.9 // F41E7.9 /// microcosm // F42A10.5.1 // F42A10.5 /// microcosm // F42A10.8 // nas-28 /// microcosm // F42F12.3 // F42F12.3 /// microcosm // F42G8.4.1 // pmk-3 /// microcosm // F42G8.4.2 // pmk-3 /// microcosm // F44A6.4 // F44A6.4 /// microcosm // F45E1.5 // F45E1.5 /// microcosm // F46A9.5.1 // skr-1 /// microcosm // F46A9.5.3 // skr-1 /// microcosm // F46C5.1 // F46C5.1 /// microcosm // F46C8.2 // col-174 /// microcosm // F46G10.6 // mxl-3 /// microcosm // F47B3.3 // F47B3.3 /// microcosm // F48B9.4 // nlp-37 /// microcosm // F48C1.8 // F48C1.8 /// microcosm // F48C11.2 // cwp-5 /// microcosm // F48D6.1.2 // taf-11.1 /// microcosm // F48G7.12 // F48G7.12 /// microcosm // F48G7.9 // F48G7.9 /// microcosm // F49H6.1 // F49H6.1 /// microcosm // F52G3.1 // F52G3.1 /// microcosm // F53C11.5a // F53C11.5 /// microcosm // F53C11.5c // F53C11.5 /// microcosm // F53E2.1 // tag-304 /// microcosm // F54A3.1 // F54A3.1 /// microcosm // F54B3.1 // F54B3.1 /// microcosm // F54C8.7a // F54C8.7 /// microcosm // F54C8.7b.1 // F54C8.7 /// microcosm // F54C9.1.1 // iff-2 /// microcosm // F54C9.1.3 // iff-2 /// microcosm // F54C9.4 // col-38 /// microcosm // F54C9.8 // puf-5 /// microcosm // F54D12.9 // F54D12.9 /// microcosm // F54D5.3.1 // F54D5.3 /// microcosm // F54E2.1 // F54E2.1 /// microcosm // F54E7.7 // rcn-1 /// microcosm // F55A11.1 // F55A11.1 /// microcosm // F55D10.5 // F55D10.5 /// microcosm // F55D12.1 // F55D12.1 /// microcosm // F55H2.1 // sod-4 /// microcosm // F55H2.2.2 // vha-14 /// microcosm // F56A8.5.2 // F56A8.5 /// microcosm // F56D6.5 // srz-20 /// microcosm // F57A8.5 // nhr-192 /// microcosm // F57B10.4 // F57B10.4 /// microcosm // F57E7.2 // F57E7.2 /// microcosm // F58A6.2 // F58A6.2 /// microcosm // F58B3.3 // lys-6 /// microcosm // F58F12.4 // F58F12.4 /// microcosm // F58F9.6 // F58F9.6 /// microcosm // F58G1.9 // F58G1.9 /// microcosm // F58H1.1a // F58H1.1 /// microcosm // F58H1.1b // F58H1.1 /// microcosm // F59B1.3 // srx-93 /// microcosm // F59D12.5 // F59D12.5 /// microcosm // F59F3.1 // ver-3 /// microcosm // H01G02.1 // H01G02.1 /// microcosm // H03G16.5 // H03G16.5 /// microcosm // H16D19.1 // clec-13 /// microcosm // H17B01.5 // H17B01.5 /// microcosm // H20J04.9 // H20J04.9 /// microcosm // H23L24.5 // pme-4 /// microcosm // H41C03.2 // H41C03.2 /// microcosm // JC8.12a // JC8.12 /// microcosm // JC8.12b.1 // JC8.12 /// microcosm // K02B2.3.1 // K02B2.3 /// microcosm // K02B2.3.3 // K02B2.3 /// microcosm // K02D7.4.2 // dsc-4 /// microcosm // K02H11.7 // str-243 /// microcosm // K03A1.5 // sur-5 /// microcosm // K03B8.11 // K03B8.11 /// microcosm // K03H1.8 // K03H1.8 /// microcosm // K04C1.6 // srg-36 /// microcosm // K05D4.8 // srz-13 /// microcosm // K06A9.2 // K06A9.2 /// microcosm // K06G5.3 // K06G5.3 /// microcosm // K07A1.6 // K07A1.6 /// microcosm // K07C5.6.2 // K07C5.6 /// microcosm // K07C6.5 // cyp-35A5 /// microcosm // K07E12.1a // dig-1 /// microcosm // K07E3.8a // vem-1 /// microcosm // K07E3.8b.2 // vem-1 /// microcosm // K08D10.10 // K08D10.10 /// microcosm // K08D10.9 // K08D10.9 /// microcosm // K08E3.6.1 // cyk-4 /// microcosm // K08E3.6.2 // cyk-4 /// microcosm // K08E5.2b.1 // nac-3 /// microcosm // K10B3.1b // K10B3.1 /// microcosm // K11D12.10a // mlk-1 /// microcosm // K11D9.1a // klp-7 /// microcosm // K11D9.1b.1 // klp-7 /// microcosm // K11D9.1b.2 // klp-7 /// microcosm // K12H4.4.1 // K12H4.4 /// microcosm // M01F1.5.2 // M01F1.5 /// microcosm // M02F4.3 // M02F4.3 /// microcosm // M03F8.6 // M03F8.6 /// microcosm // M04B2.6 // M04B2.6 /// microcosm // M117.6 // M117.6 /// miRecords // NM_059132 // unc-63 /// miRecords // NM_059998 // unc-29 /// miRecords // NM_060040 // mef-2 /// microcosm // R02C2.3 // tag-40 /// microcosm // R03A10.3 // R03A10.3 /// microcosm // R03A10.5 // R03A10.5 /// microcosm // R03E1.2.1 // R03E1.2 /// microcosm // R03H10.6 // R03H10.6 /// microcosm // R06C7.9 // R06C7.9 /// microcosm // R07B1.1 // vab-15 /// microcosm // R07B5.8a.1 // R07B5.8 /// microcosm // R07B5.8a.2 // R07B5.8 /// microcosm // R07C12.1 // R07C12.1 /// microcosm // R07C12.2 // R07C12.2 /// microcosm // R07C3.10 // R07C3.10 /// microcosm // R07E3.1a.1 // R07E3.1 /// microcosm // R07E3.1b.2 // R07E3.1 /// microcosm // R08C7.6 // R08C7.6 /// microcosm // R08C7.7 // str-185 /// microcosm // R08D7.5 // R08D7.5 /// microcosm // R08D7.6a // pde-2 /// microcosm // R09B5.3.2 // cnc-2 /// microcosm // R09F10.4 // inx-5 /// microcosm // R09F10.5 // R09F10.5 /// microcosm // R105.1 // R105.1 /// microcosm // R10E9.3 // R10E9.3 /// microcosm // R11A8.2 // R11A8.2 /// microcosm // R11E3.8.2 // dpf-5 /// microcosm // R11E3.8.3 // dpf-5 /// microcosm // R11G1.3 // gst-11 /// microcosm // R13F6.4c.1 // ten-1 /// microcosm // R13F6.4d // ten-1 /// microcosm // R13H4.1 // nph-4 /// microcosm // R151.8 // R151.8 /// microcosm // R160.1a // dpy-23 /// microcosm // R160.1b.1 // dpy-23 /// microcosm // R53.2 // R53.2 /// microcosm // R74.5b.1 // asd-1 /// microcosm // R74.6 // R74.6 /// microcosm // R74.8a // R74.8 /// microcosm // R74.8b // R74.8 /// microcosm // T01B7.8 // T01B7.8 /// microcosm // T01D3.5 // T01D3.5 /// microcosm // T01H3.1.2 // vha-4 /// microcosm // T02H6.11.2 // T02H6.11 /// microcosm // T03D3.1 // ugt-53 /// microcosm // T03F6.1 // qdpr-1 /// microcosm // T03G6.2c // nhr-40 /// microcosm // T04A11.3 // T04A11.3 /// microcosm // T04F3.1 // T04F3.1 /// microcosm // T04H1.10 // srw-80 /// microcosm // T05A7.1 // T05A7.1 /// microcosm // T05A7.10 // fut-5 /// microcosm // T05B4.12 // T05B4.12 /// microcosm // T05B4.2 // nhr-57 /// microcosm // T05C3.2 // T05C3.2 /// microcosm // T05F1.1.1 // T05F1.1 /// microcosm // T05G11.3 // srw-26 /// microcosm // T06D8.1a // T06D8.1 /// microcosm // T07A9.9c.6 // T07A9.9 /// microcosm // T07D10.4 // clec-15 /// microcosm // T07D3.2 // T07D3.2 /// microcosm // T07E3.6b.1 // T07E3.6 /// microcosm // T07H3.5 // clec-20 /// microcosm // T08B6.3 // str-161 /// microcosm // T09A5.1b // cex-2 /// microcosm // T09A5.8 // T09A5.8 /// microcosm // T09D3.3 // T09D3.3 /// microcosm // T09E8.1e // T09E8.1 /// microcosm // T10F2.1b.1 // grs-1 /// microcosm // T10F2.1b.2 // grs-1 /// microcosm // T10F2.1b.3 // grs-1 /// microcosm // T10G3.3.1 // T10G3.3 /// microcosm // T10H4.3 // srw-22 /// microcosm // T11F1.5 // srw-79 /// microcosm // T11F9.19 // T11F9.19 /// microcosm // T12C9.6 // nhr-16 /// microcosm // T13G4.2 // T13G4.2 /// microcosm // T14F9.1.2 // vha-15 /// microcosm // T14F9.3 // T14F9.3 /// microcosm // T14G8.4 // T14G8.4 /// microcosm // T15B7.11 // T15B7.11 /// microcosm // T15B7.17 // T15B7.17 /// microcosm // T16G1.1 // pqn-67 /// microcosm // T18D3.9 // T18D3.9 /// microcosm // T18H9.7a // tag-232 /// microcosm // T19B10.8 // T19B10.8 /// microcosm // T19D7.6 // T19D7.6 /// microcosm // T20D4.20 // T20D4.20 /// microcosm // T20G5.10 // T20G5.10 /// microcosm // T21B10.3 // T21B10.3 /// microcosm // T21B4.15 // T21B4.15 /// microcosm // T21E12.2 // T21E12.2 /// microcosm // T22B2.7 // T22B2.7 /// microcosm // T22C8.3 // T22C8.3 /// microcosm // T22H2.2 // T22H2.2 /// microcosm // T23B12.4 // T23B12.4 /// microcosm // T23B7.3 // T23B7.3 /// microcosm // T23D8.7 // T23D8.7 /// microcosm // T23G5.1.2 // rnr-1 /// microcosm // T23G5.1.3 // rnr-1 /// microcosm // T24A6.11 // nhr-222 /// microcosm // T24B8.7b // T24B8.7 /// microcosm // T24D5.3 // T24D5.3 /// microcosm // T24H10.7b // T24H10.7 /// microcosm // T24H10.7c // T24H10.7 /// microcosm // T24H7.5a // tat-4 /// microcosm // T25B9.3a // T25B9.3 /// microcosm // T26A5.2a // T26A5.2 /// microcosm // T26A5.2b // T26A5.2 /// microcosm // T26C5.2 // T26C5.2 /// microcosm // T27A1.3 // T27A1.3 /// microcosm // T27D12.3 // T27D12.3 /// microcosm // W01B6.1 // cwn-2 /// microcosm // W02A2.2 // far-6 /// microcosm // W02D9.9 // W02D9.9 /// microcosm // W03H1.2 // elc-2 /// microcosm // W04B5.6 // W04B5.6 /// microcosm // W06F12.1a // lit-1 /// microcosm // W06F12.1b.1 // lit-1 /// microcosm // W06H8.8c // ttn-1 /// microcosm // W09C2.1b // elt-1 /// microcosm // W09C5.4 // ins-33 /// microcosm // Y102A5A.1 // cand-1 /// microcosm // Y102A5C.2 // Y102A5C.2 /// microcosm // Y105C5A.1 // Y105C5A.1 /// microcosm // Y105E8A.3 // Y105E8A.3 /// microcosm // Y106G6E.4 // Y106G6E.4 /// microcosm // Y106G6H.12 // duo-3 /// microcosm // Y116A8C.25 // Y116A8C.25 /// microcosm // Y116A8C.29 // Y116A8C.29 /// microcosm // Y17G7B.17 // Y17G7B.17 /// microcosm // Y22D7AR.6 // Y22D7AR.6 /// microcosm // Y22F5A.3 // ric-4 /// microcosm // Y26E6A.2 // Y26E6A.2 /// microcosm // Y32B12A.1 // Y32B12A.1 /// microcosm // Y37E3.16.2 // Y37E3.16 /// microcosm // Y38E10A.5 // clec-4 /// microcosm // Y38F2AL.3a.2 // vha-11 /// microcosm // Y39A3B.4 // srd-66 /// microcosm // Y39C12A.5 // sre-16 /// microcosm // Y39G10AR.17 // Y39G10AR.17 /// microcosm // Y39G10AR.3 // Y39G10AR.3 /// microcosm // Y41D4B.5.1 // rps-28 /// microcosm // Y43C5A.6a // rad-51 /// microcosm // Y43C5A.6b // rad-51 /// microcosm // Y43F4B.5a.1 // Y43F4B.5 /// microcosm // Y43F4B.5a.2 // Y43F4B.5 /// microcosm // Y45F10C.6 // Y45F10C.6 /// microcosm // Y46E12BR.1 // Y46E12BR.1 /// microcosm // Y47H10A.5 // Y47H10A.5 /// microcosm // Y48G1C.7 // Y48G1C.7 /// microcosm // Y48G8AL.14 // aps-3 /// microcosm // Y49A3A.2.3 // vha-13 /// microcosm // Y49E10.9 // tag-222 /// microcosm // Y49F6C.3 // bath-9 /// microcosm // Y54E10A.15 // cdt-1 /// microcosm // Y54E5B.1a // smp-1 /// microcosm // Y54G2A.37 // Y54G2A.37 /// microcosm // Y54H5A.4.1 // Y54H5A.4 /// microcosm // Y55F3AM.15 // csn-4 /// microcosm // Y55F3C.10 // Y55F3C.10 /// microcosm // Y57G11C.14 // Y57G11C.14 /// microcosm // Y57G11C.34 // Y57G11C.34 /// microcosm // Y57G11C.52 // Y57G11C.52 /// microcosm // Y57G7A.10a // Y57G7A.10 /// microcosm // Y58A7A.1 // Y58A7A.1 /// microcosm // Y59A8B.25 // Y59A8B.25 /// microcosm // Y59A8B.8 // Y59A8B.8 /// microcosm // Y59H11AL.1a // Y59H11AL.1 /// microcosm // Y59H11AL.1b // Y59H11AL.1 /// microcosm // Y67A6A.2 // nhr-62 /// microcosm // Y69A2AR.7b.1 // Y69A2AR.7 /// microcosm // Y69A2AR.7b.2 // Y69A2AR.7 /// microcosm // Y69A2AR.7c // Y69A2AR.7 /// microcosm // Y69E1A.4 // Y69E1A.4 /// microcosm // Y71F9B.16 // dnj-30 /// microcosm // Y71H2AM.24 // Y71H2AM.24 /// microcosm // Y71H2AM.6.1 // Y71H2AM.6 /// microcosm // Y71H2AM.6.2 // Y71H2AM.6 /// microcosm // Y73B6BL.30 // Y73B6BL.30 /// microcosm // Y73B6BL.4 // Y73B6BL.4 /// microcosm // Y74C10AL.2.1 // Y74C10AL.2 /// microcosm // Y74C10AL.2.2 // Y74C10AL.2 /// microcosm // Y75B8A.34 // Y75B8A.34 /// microcosm // Y76A2B.4 // Y76A2B.4 /// microcosm // Y81B9A.1 // Y81B9A.1 /// microcosm // ZC239.5 // ZC239.5 /// microcosm // ZC416.6 // ZC416.6 /// microcosm // ZK1010.8.2 // ZK1010.8 /// microcosm // ZK1058.4.1 // tag-252 /// microcosm // ZK1058.4.2 // tag-252 /// microcosm // ZK1067.2 // ZK1067.2 /// microcosm // ZK1098.1 // ZK1098.1 /// microcosm // ZK1193.1 // col-19 /// microcosm // ZK1248.15 // ZK1248.15 /// microcosm // ZK1290.15 // ZK1290.15 /// microcosm // ZK1320.5 // ZK1320.5 /// microcosm // ZK265.6 // ZK265.6 /// microcosm // ZK287.4 // ZK287.4 /// microcosm // ZK287.8b // her-1 /// microcosm // ZK616.1 // ZK616.1 /// microcosm // ZK652.11.1 // cuc-1 /// microcosm // ZK652.11.2 // cuc-1 /// microcosm // ZK652.3 // tag-277 /// microcosm // ZK783.1 // fbn-1 /// microcosm // ZK84.2 // ZK84.2 /// microcosm // ZK945.4 // ZK945.4 /// microcosm // ZK970.4.1 // vha-9 /// microcosm // ZK970.4.2 // vha-9 /// microcosm // ZK973.11 // ZK973.11 miRNA-4_0 May 13, 2014 miRBase cel-miR-1-3p
MIMAT0020302_st 20500006 MIMAT0020302 cel-miR-2-5p miRNA Caenorhabditis elegans I:9372817-9372838 (-) 22 CAUCAAAGCGGUGGUUGAUGUG F16A11.3a.1 // sense // intron // 5 /// F16A11.3a.2 // sense // intron // 5 /// F16A11.3b.1 // sense // intron // 5 /// F16A11.3b.2 // sense // intron // 5 /// F16A11.3c.1 // sense // intron // 5 /// F16A11.3c.2 // sense // intron // 5 /// F16A11.3d // sense // intron // 8 /// M04C9.7 // sense // exon // 1 cel-mir-2 // I:9372760-9372857 (-) /// cel-mir-71 // I:9379919-9380012 (-) --- miRNA-4_0 May 13, 2014 miRBase cel-miR-2-5p
MIMAT0000004_st 20500007 MIMAT0000004 cel-miR-2-3p miRNA Caenorhabditis elegans I:9372775-9372797 (-) 23 UAUCACAGCCAGCUUUGAUGUGC F16A11.3a.1 // sense // intron // 5 /// F16A11.3a.2 // sense // intron // 5 /// F16A11.3b.1 // sense // intron // 5 /// F16A11.3b.2 // sense // intron // 5 /// F16A11.3c.1 // sense // intron // 5 /// F16A11.3c.2 // sense // intron // 5 /// F16A11.3d // sense // intron // 8 /// M04C9.7 // sense // exon // 1 cel-mir-2 // I:9372760-9372857 (-) /// cel-mir-71 // I:9379919-9380012 (-) MTI // --- // F40H3.11 /// microcosm // B0034.5 // B0034.5 /// microcosm // B0035.14.2 // dnj-1 /// microcosm // B0222.1 // B0222.1 /// microcosm // B0222.4 // tag-38 /// microcosm // B0252.3c.1 // B0252.3 /// microcosm // B0252.4a // cyn-10 /// microcosm // B0285.8 // ckb-1 /// microcosm // B0294.3 // B0294.3 /// microcosm // B0302.1c // kin-25 /// microcosm // B0303.9 // B0303.9 /// microcosm // B0310.2.1 // B0310.2 /// microcosm // B0310.2.2 // B0310.2 /// microcosm // B0310.4 // B0310.4 /// microcosm // B0414.8b // B0414.8 /// microcosm // B0416.1 // B0416.1 /// microcosm // B0507.3a // B0507.3 /// microcosm // B0507.3b // B0507.3 /// microcosm // C01F6.6e.5 // tag-60 /// microcosm // C01G10.16 // C01G10.16 /// microcosm // C01G6.8a // cam-1 /// microcosm // C02F4.5 // C02F4.5 /// microcosm // C03F11.4.2 // C03F11.4 /// microcosm // C03H5.7 // C03H5.7 /// microcosm // C04A11.4 // adm-2 /// microcosm // C05D11.2.1 // vps-16 /// microcosm // C05D11.2.2 // vps-16 /// microcosm // C05E7.3 // C05E7.3 /// microcosm // C05G5.2 // C05G5.2 /// microcosm // C06G4.4 // C06G4.4 /// microcosm // C06G8.3b.1 // C06G8.3 /// microcosm // C06G8.3b.2 // C06G8.3 /// microcosm // C06H2.6.1 // C06H2.6 /// microcosm // C06H2.6.2 // C06H2.6 /// microcosm // C07G1.4a // wsp-1 /// microcosm // C07G1.5.1 // hgrs-1 /// microcosm // C08B11.2 // hda-2 /// microcosm // C09B7.2 // C09B7.2 /// microcosm // C09F5.3 // C09F5.3 /// microcosm // C09G12.3 // srz-78 /// microcosm // C09G12.8b // ced-10 /// microcosm // C09H5.9 // str-130 /// microcosm // C09H6.2a // lin-10 /// microcosm // C09H6.2b // lin-10 /// microcosm // C10A4.8 // C10A4.8 /// microcosm // C10C6.6 // C10C6.6 /// microcosm // C10F3.6 // fut-8 /// microcosm // C11G10.1 // C11G10.1 /// microcosm // C13A2.4 // C13A2.4 /// microcosm // C13A2.5 // C13A2.5 /// microcosm // C13B9.3 // C13B9.3 /// microcosm // C13B9.4c.2 // C13B9.4 /// microcosm // C14A4.7a // C14A4.7 /// microcosm // C15C8.4.1 // C15C8.4 /// microcosm // C15H9.4 // C15H9.4 /// microcosm // C16A3.2 // C16A3.2 /// microcosm // C16D9.6 // C16D9.6 /// microcosm // C17A2.1 // nhr-257 /// microcosm // C18B10.2 // srbc-10 /// microcosm // C18E9.2 // C18E9.2 /// microcosm // C18E9.3a // pqn-14 /// microcosm // C18E9.3c.2 // pqn-14 /// microcosm // C18F10.7a.2 // C18F10.7 /// microcosm // C18H9.5 // C18H9.5 /// microcosm // C24B5.3 // ptr-1 /// microcosm // C24G6.2a // C24G6.2 /// microcosm // C24G6.2b // C24G6.2 /// microcosm // C24H12.4a // C24H12.4 /// microcosm // C25A1.5 // C25A1.5 /// microcosm // C25A8.4 // C25A8.4 /// microcosm // C25B8.6 // nhr-120 /// microcosm // C25D7.3 // sdc-3 /// microcosm // C25D7.5 // C25D7.5 /// microcosm // C25H3.12 // C25H3.12 /// microcosm // C25H3.5 // flp-27 /// microcosm // C25H3.8 // C25H3.8 /// microcosm // C26C6.6 // C26C6.6 /// microcosm // C28D4.9 // nhr-138 /// microcosm // C28H8.9b // C28H8.9 /// microcosm // C29E4.5a // tag-250 /// microcosm // C30B5.2a // C30B5.2 /// microcosm // C30G4.2 // C30G4.2 /// microcosm // C30G4.6 // C30G4.6 /// microcosm // C30H7.2b // C30H7.2 /// microcosm // C31B8.6 // str-46 /// microcosm // C32F10.4.1 // C32F10.4 /// microcosm // C33A12.2 // nlp-35 /// microcosm // C33A12.6 // ugt-21 /// microcosm // C33D9.5 // C33D9.5 /// microcosm // C34C6.8 // ceh-7 /// microcosm // C34D4.4a // C34D4.4 /// microcosm // C34F6.11 // C34F6.11 /// microcosm // C35C5.8a // C35C5.8 /// microcosm // C35C5.8b // C35C5.8 /// microcosm // C36E8.6 // C36E8.6 /// microcosm // C37C3.8a.2 // tag-253 /// microcosm // C37C3.8a.4 // tag-253 /// microcosm // C39B10.4 // C39B10.4 /// microcosm // C39E9.1 // C39E9.1 /// microcosm // C39F7.4.1 // rab-1 /// microcosm // C39F7.4.2 // rab-1 /// microcosm // C40H5.2 // C40H5.2 /// microcosm // C42C1.3 // C42C1.3 /// microcosm // C43F9.5 // C43F9.5 /// microcosm // C43H6.8 // hlh-15 /// microcosm // C44B7.2a.1 // C44B7.2 /// microcosm // C44C1.4a // vps-45 /// microcosm // C44E4.6.1 // acbp-1 /// microcosm // C44E4.6.2 // acbp-1 /// microcosm // C44E4.6.4 // acbp-1 /// microcosm // C44E4.6.5 // acbp-1 /// microcosm // C44E4.6.6 // acbp-1 /// microcosm // C45B2.5.1 // gln-1 /// microcosm // C45G3.3 // gip-2 /// microcosm // C47A10.11 // srh-290 /// microcosm // C47E12.3 // C47E12.3 /// microcosm // C49C3.11 // C49C3.11 /// microcosm // C49D10.9 // nhr-261 /// microcosm // C50A2.3 // C50A2.3 /// microcosm // C50B8.6 // C50B8.6 /// microcosm // C50D2.5 // C50D2.5 /// microcosm // C51F7.1 // frm-7 /// microcosm // C52D10.9.1 // skr-8 /// microcosm // C52D10.9.2 // skr-8 /// microcosm // C53B4.3.1 // C53B4.3 /// microcosm // C53B4.3.2 // C53B4.3 /// microcosm // C53B4.4a // C53B4.4 /// microcosm // C53B4.7a.1 // bre-1 /// microcosm // C53B4.7c.2 // bre-1 /// microcosm // C53C11.4 // C53C11.4 /// microcosm // C54A12.2 // C54A12.2 /// microcosm // C54C8.7 // clec-11 /// microcosm // C54G4.5 // C54G4.5 /// microcosm // CD4.1 // CD4.1 /// microcosm // D1007.5a.1 // D1007.5 /// microcosm // D1007.5a.2 // D1007.5 /// microcosm // D1009.1a // D1009.1 /// microcosm // D1022.7a.1 // aka-1 /// microcosm // D1022.7a.2 // aka-1 /// microcosm // D1022.7b // aka-1 /// microcosm // D1037.4 // rab-8 /// microcosm // D2023.6 // D2023.6 /// microcosm // E04F6.7 // dhs-7 /// microcosm // EGAP5.1 // EGAP5.1 /// microcosm // F02C12.1 // F02C12.1 /// microcosm // F02C12.5a // cyp-13B1 /// microcosm // F02G3.1a // ncam-1 /// microcosm // F02G3.1c // ncam-1 /// microcosm // F07B7.1 // F07B7.1 /// microcosm // F07E5.8 // F07E5.8 /// microcosm // F07G11.7 // F07G11.7 /// microcosm // F07G6.7 // fbxa-53 /// microcosm // F08A8.3 // F08A8.3 /// microcosm // F08B4.1b // dic-1 /// microcosm // F08E10.2 // srbc-61 /// microcosm // F08F8.8 // F08F8.8 /// microcosm // F08G12.3 // F08G12.3 /// microcosm // F08G5.7 // F08G5.7 /// microcosm // F09C12.2 // F09C12.2 /// microcosm // F09C6.1 // F09C6.1 /// microcosm // F09E8.2 // F09E8.2 /// microcosm // F09F3.5 // F09F3.5 /// microcosm // F10D2.5 // ugt-40 /// microcosm // F10D7.2.2 // F10D7.2 /// microcosm // F10F2.1 // F10F2.1 /// microcosm // F10G7.5a // F10G7.5 /// microcosm // F10G7.5b // F10G7.5 /// microcosm // F10G8.5 // ncs-2 /// microcosm // F10G8.8 // F10G8.8 /// microcosm // F12B6.1 // abt-2 /// microcosm // F12F6.3.2 // rib-1 /// microcosm // F12F6.8 // F12F6.8 /// microcosm // F13A2.2 // F13A2.2 /// microcosm // F13B9.5.1 // ksr-1 /// microcosm // F13B9.5.2 // ksr-1 /// microcosm // F13C5.1 // F13C5.1 /// microcosm // F13G3.3 // F13G3.3 /// microcosm // F14A5.1 // nhr-264 /// microcosm // F14E5.5 // F14E5.5 /// microcosm // F14E5.6 // F14E5.6 /// microcosm // F15B9.2 // far-4 /// microcosm // F15C11.2a // F15C11.2 /// microcosm // F15C11.2b // F15C11.2 /// microcosm // F15C11.2c // F15C11.2 /// microcosm // F15G9.5 // F15G9.5 /// microcosm // F15H10.2 // col-13 /// microcosm // F16A11.3c // F16A11.3 /// microcosm // F16G10.7 // F16G10.7 /// microcosm // F16H11.1 // F16H11.1 /// microcosm // F17A9.3 // F17A9.3 /// microcosm // F17E9.5 // F17E9.5 /// microcosm // F19F10.6 // F19F10.6 /// microcosm // F20D1.2 // F20D1.2 /// microcosm // F20D6.5 // F20D6.5 /// microcosm // F22D6.12.1 // gly-19 /// microcosm // F23B12.7.2 // F23B12.7 /// microcosm // F23H11.4a // F23H11.4 /// microcosm // F23H11.9a // F23H11.9 /// microcosm // F23H11.9b.1 // F23H11.9 /// microcosm // F25B5.1a // F25B5.1 /// microcosm // F25B5.1b // F25B5.1 /// microcosm // F25H2.10.2 // rpa-0 /// microcosm // F26A1.8 // F26A1.8 /// microcosm // F26A3.1 // F26A3.1 /// microcosm // F26H9.5 // F26H9.5 /// microcosm // F28H7.9 // sre-6 /// microcosm // F29G9.3 // aps-1 /// microcosm // F30A10.8b // stn-1 /// microcosm // F31D5.2 // F31D5.2 /// microcosm // F31D5.3c // tag-149 /// microcosm // F32B5.3 // F32B5.3 /// microcosm // F32B6.1.1 // nhr-4 /// microcosm // F32B6.1.2 // nhr-4 /// microcosm // F33E11.3 // F33E11.3 /// microcosm // F33E2.7 // F33E2.7 /// microcosm // F35F10.1 // F35F10.1 /// microcosm // F35F11.3 // F35F11.3 /// microcosm // F36H1.2b // tag-144 /// microcosm // F37B12.3 // F37B12.3 /// microcosm // F37D6.6 // tag-68 /// microcosm // F38B7.3 // F38B7.3 /// microcosm // F39B1.1 // F39B1.1 /// microcosm // F39B2.10.2 // dnj-12 /// microcosm // F41E6.9.2 // F41E6.9 /// microcosm // F41G3.19 // F41G3.19 /// microcosm // F43B10.2a // tag-343 /// microcosm // F43B10.2b // tag-343 /// microcosm // F43C1.2b // mpk-1 /// microcosm // F44E2.2b // F44E2.2 /// microcosm // F44E2.4 // F44E2.4 /// microcosm // F44F1.2 // F44F1.2 /// microcosm // F45C12.1 // F45C12.1 /// microcosm // F45E1.5 // F45E1.5 /// microcosm // F45G2.10 // F45G2.10 /// microcosm // F46A9.6.2 // mec-8 /// microcosm // F46E10.8 // ubh-1 /// microcosm // F46F11.9a // F46F11.9 /// microcosm // F46F11.9b // F46F11.9 /// microcosm // F46F2.4 // F46F2.4 /// microcosm // F46H5.5 // F46H5.5 /// microcosm // F47B10.3 // F47B10.3 /// microcosm // F47B8.9b // srm-6 /// microcosm // F48G7.4 // F48G7.4 /// microcosm // F49C12.2 // F49C12.2 /// microcosm // F49C5.6 // str-223 /// microcosm // F49D11.2 // F49D11.2 /// microcosm // F49D11.7 // F49D11.7 /// microcosm // F52D10.5 // sto-3 /// microcosm // F52E4.5 // F52E4.5 /// microcosm // F53A2.8a // mtm-6 /// microcosm // F53A2.8c // mtm-6 /// microcosm // F53B1.4 // F53B1.4 /// microcosm // F53B2.4 // sru-13 /// microcosm // F53B2.5 // F53B2.5 /// microcosm // F53C3.13b.1 // F53C3.13 /// microcosm // F53F10.4.2 // unc-108 /// microcosm // F53F4.9 // srd-11 /// microcosm // F53G2.2 // F53G2.2 /// microcosm // F54B3.1 // F54B3.1 /// microcosm // F54C9.2 // stc-1 /// microcosm // F54D7.3 // F54D7.3 /// microcosm // F55A11.2 // syn-3 /// microcosm // F55B11.3 // F55B11.3 /// microcosm // F55B11.5 // F55B11.5 /// microcosm // F55B12.6 // str-165 /// microcosm // F55C5.7 // F55C5.7 /// microcosm // F55F8.2b // F55F8.2 /// microcosm // F55G11.7 // F55G11.7 /// microcosm // F55H12.6a // F55H12.6 /// microcosm // F56A12.2 // F56A12.2 /// microcosm // F56A6.5 // F56A6.5 /// microcosm // F56B3.10 // gst-40 /// microcosm // F56D2.6b.1 // F56D2.6 /// microcosm // F56D2.6b.2 // F56D2.6 /// microcosm // F56D6.1 // clec-68 /// microcosm // F56H1.5 // F56H1.5 /// microcosm // F56H11.1a.1 // fbl-1 /// microcosm // F56H11.1a.2 // fbl-1 /// microcosm // F57B9.4b // coq-2 /// microcosm // F57C9.1a // F57C9.1 /// microcosm // F57C9.1b // F57C9.1 /// microcosm // F57G12.2 // F57G12.2 /// microcosm // F57G8.1 // srh-180 /// microcosm // F58B4.6 // F58B4.6 /// microcosm // F58D7.1 // srsx-17 /// microcosm // F58G11.6 // F58G11.6 /// microcosm // F59A3.4 // F59A3.4 /// microcosm // F59B1.7 // srx-41 /// microcosm // F59B8.2.1 // F59B8.2 /// microcosm // F59E11.1 // srx-1 /// microcosm // F59G1.1b.1 // cgt-3 /// microcosm // F59G1.1c.1 // cgt-3 /// microcosm // F59G1.1d.5 // cgt-3 /// microcosm // H01G02.3b // H01G02.3 /// microcosm // H03E18.2 // H03E18.2 /// microcosm // H03G16.6 // H03G16.6 /// microcosm // H05B21.2 // srh-248 /// microcosm // H06O01.2 // H06O01.2 /// microcosm // H14N18.1b.2 // unc-23 /// microcosm // H20J18.1b // scd-1 /// microcosm // H22D14.1 // nhr-267 /// microcosm // H24G06.1d.2 // H24G06.1 /// microcosm // H32K16.1 // H32K16.1 /// microcosm // K01A12.3 // K01A12.3 /// microcosm // K02B12.7 // K02B12.7 /// microcosm // K02B9.1 // K02B9.1 /// microcosm // K02B9.4 // elt-3 /// microcosm // K02D7.6 // grl-26 /// microcosm // K02F3.6 // K02F3.6 /// microcosm // K02F6.4 // K02F6.4 /// microcosm // K03A1.2.1 // K03A1.2 /// microcosm // K04A8.6 // K04A8.6 /// microcosm // K05C4.4 // K05C4.4 /// microcosm // K05F1.7 // msp-63 /// microcosm // K05F6.2 // fbxb-50 /// microcosm // K05F6.3 // fbxb-51 /// microcosm // K06H6.6 // K06H6.6 /// microcosm // K07E3.2 // K07E3.2 /// microcosm // K07E3.8a // vem-1 /// microcosm // K08A2.5a.3 // nhr-88 /// microcosm // K08B4.4 // ugt-20 /// microcosm // K08D10.2 // dnj-15 /// microcosm // K09C8.7 // K09C8.7 /// microcosm // K10B2.2a // K10B2.2 /// microcosm // K10B2.2b // K10B2.2 /// microcosm // K10B4.5 // srd-3 /// microcosm // K10D2.6.2 // emb-8 /// microcosm // K10D3.3 // taf-11.2 /// microcosm // K11G12.1a // nas-11 /// microcosm // K12H4.8 // dcr-1 /// microcosm // K12H6.10 // K12H6.10 /// microcosm // M01B12.3 // arx-7 /// microcosm // M01E5.4 // M01E5.4 /// microcosm // M02A10.1 // M02A10.1 /// microcosm // M02F4.9 // M02F4.9 /// microcosm // M03A1.6b.2 // ipla-1 /// microcosm // M04D8.6 // xbx-3 /// microcosm // M05B5.2 // M05B5.2 /// microcosm // M05B5.5a.1 // hlh-2 /// microcosm // M05B5.5a.2 // hlh-2 /// microcosm // M176.2.1 // M176.2 /// microcosm // M176.2.2 // M176.2 /// microcosm // M28.10 // M28.10 /// microcosm // M88.1.2 // ugt-62 /// microcosm // R02C2.5 // str-121 /// microcosm // R03A10.2 // flp-32 /// microcosm // R04B5.4 // nhr-12 /// microcosm // R04F11.1 // R04F11.1 /// microcosm // R05H5.2 // cdc-25.4 /// microcosm // R06C7.5b.1 // R06C7.5 /// microcosm // R06C7.5b.2 // R06C7.5 /// microcosm // R06F6.6 // R06F6.6 /// microcosm // R06F6.8b.2 // R06F6.8 /// microcosm // R07A4.2 // R07A4.2 /// microcosm // R07B7.1 // clh-6 /// microcosm // R07B7.8 // R07B7.8 /// microcosm // R07E3.6 // R07E3.6 /// microcosm // R07H5.8.2 // R07H5.8 /// microcosm // R09D1.11 // R09D1.11 /// microcosm // R10D12.7 // R10D12.7 /// microcosm // R10H10.2 // spe-26 /// microcosm // R12B2.2 // R12B2.2 /// microcosm // R13D11.1 // R13D11.1 /// microcosm // R144.2a // R144.2 /// microcosm // R144.4a // wip-1 /// microcosm // R144.4b // wip-1 /// microcosm // R160.7 // lst-2 /// microcosm // R166.1 // R166.1 /// microcosm // R193.2 // R193.2 /// microcosm // R53.8 // R53.8 /// microcosm // T01B11.1 // T01B11.1 /// microcosm // T03F1.1.1 // T03F1.1 /// microcosm // T03F1.1.2 // T03F1.1 /// microcosm // T04G9.3.1 // ile-2 /// microcosm // T04G9.3.2 // ile-2 /// microcosm // T05A10.6 // T05A10.6 /// microcosm // T05A6.1 // cki-1 /// microcosm // T05A7.2 // T05A7.2 /// microcosm // T05A8.1 // T05A8.1 /// microcosm // T05E7.3 // T05E7.3 /// microcosm // T05G5.10.1 // iff-1 /// microcosm // T05G5.5 // T05G5.5 /// microcosm // T06H11.4 // moc-1 /// microcosm // T07G12.5 // T07G12.5 /// microcosm // T09F3.1 // T09F3.1 /// microcosm // T09F3.3.3 // gpd-1 /// microcosm // T10E9.4.1 // T10E9.4 /// microcosm // T10H4.8 // srw-19 /// microcosm // T12A2.10 // srg-9 /// microcosm // T12A2.2.1 // T12A2.2 /// microcosm // T12A2.2.2 // T12A2.2 /// microcosm // T12A2.2.3 // T12A2.2 /// microcosm // T12B5.2 // fbxa-54 /// microcosm // T12E12.1.2 // T12E12.1 /// microcosm // T13H5.1b // T13H5.1 /// microcosm // T14G10.2a.1 // pxf-1 /// microcosm // T16A1.8 // fbxb-37 /// microcosm // T17E9.1a // kin-18 /// microcosm // T18D3.9 // T18D3.9 /// microcosm // T18H9.4 // str-177 /// microcosm // T19C4.4 // srg-40 /// microcosm // T20G5.11.1 // rde-4 /// microcosm // T20G5.11.2 // rde-4 /// microcosm // T20H4.2 // T20H4.2 /// microcosm // T21C9.13 // T21C9.13 /// microcosm // T22B11.3 // T22B11.3 /// microcosm // T22E7.2 // T22E7.2 /// microcosm // T22H6.2b // T22H6.2 /// microcosm // T23G11.2.2 // gna-2 /// microcosm // T23G7.4 // sec-5 /// microcosm // T24A6.4 // sri-21 /// microcosm // T24C4.4 // T24C4.4 /// microcosm // T24D5.6 // T24D5.6 /// microcosm // T24E12.1 // T24E12.1 /// microcosm // T25B9.9.1 // T25B9.9 /// microcosm // T25B9.9.2 // T25B9.9 /// microcosm // T25F10.2.1 // dbl-1 /// microcosm // T25F10.2.2 // dbl-1 /// microcosm // T25G12.4 // rab-6.2 /// microcosm // T26E3.4 // T26E3.4 /// microcosm // T27C10.3 // T27C10.3 /// microcosm // T27C5.8 // T27C5.8 /// microcosm // T27E4.1 // T27E4.1 /// microcosm // T27E9.7.2 // T27E9.7 /// microcosm // T28B4.1b // T28B4.1 /// microcosm // T28B4.1c // T28B4.1 /// microcosm // T28F2.3 // cah-6 /// microcosm // T28F3.4a.1 // T28F3.4 /// microcosm // T28F3.4a.2 // T28F3.4 /// microcosm // VC5.6 // nhr-286 /// microcosm // VF11C1L.1 // ppk-3 /// microcosm // W01A8.3 // W01A8.3 /// microcosm // W01F3.1a // W01F3.1 /// microcosm // W01F3.1b // W01F3.1 /// microcosm // W01H2.3b // rab-37 /// microcosm // W02D3.4 // W02D3.4 /// microcosm // W02D3.5.1 // lbp-6 /// microcosm // W02D3.5.2 // lbp-6 /// microcosm // W02D7.4 // W02D7.4 /// microcosm // W03D2.9 // W03D2.9 /// microcosm // W03F8.9 // gpa-18 /// microcosm // W04E12.6 // clec-49 /// microcosm // W05B2.6 // col-92 /// microcosm // W06B3.2b // sma-5 /// microcosm // W06D12.7 // srh-31 /// microcosm // W07B8.4 // W07B8.4 /// microcosm // W07G1.3 // zip-3 /// microcosm // W07G4.3.1 // W07G4.3 /// microcosm // W07G4.3.2 // W07G4.3 /// microcosm // W09B7.1 // W09B7.1 /// microcosm // W09C2.1b // elt-1 /// microcosm // W09G3.3 // tag-229 /// microcosm // Y102A5B.1 // clec-27 /// microcosm // Y102E9.1a.1 // odr-4 /// microcosm // Y102E9.1a.3 // odr-4 /// microcosm // Y102E9.1c // odr-4 /// microcosm // Y104H12D.3 // Y104H12D.3 /// microcosm // Y105E8A.2 // Y105E8A.2 /// microcosm // Y105E8A.32 // Y105E8A.32 /// microcosm // Y105E8A.4 // ech-7 /// microcosm // Y105E8A.9 // apg-1 /// microcosm // Y105E8B.2a // exoc-8 /// microcosm // Y105E8B.2b.1 // exoc-8 /// microcosm // Y105E8B.4 // bath-40 /// microcosm // Y105E8B.5 // Y105E8B.5 /// microcosm // Y106G6A.5 // Y106G6A.5 /// microcosm // Y106G6E.4 // Y106G6E.4 /// microcosm // Y106G6H.7 // sec-8 /// microcosm // Y110A2AL.8b // ptc-3 /// microcosm // Y111B2A.13 // Y111B2A.13 /// microcosm // Y113G7A.14 // Y113G7A.14 /// microcosm // Y113G7B.11 // Y113G7B.11 /// microcosm // Y116F11B.12b.1 // gly-4 /// microcosm // Y116F11B.12b.2 // gly-4 /// microcosm // Y116F11B.6 // Y116F11B.6 /// microcosm // Y11D7A.4 // rab-28 /// microcosm // Y11D7A.5 // Y11D7A.5 /// microcosm // Y18D10A.13 // pad-1 /// microcosm // Y22D7AL.8 // sms-3 /// microcosm // Y22D7AR.2 // Y22D7AR.2 /// microcosm // Y32G9A.10 // Y32G9A.10 /// microcosm // Y32G9A.3 // Y32G9A.3 /// microcosm // Y37D8A.25 // Y37D8A.25 /// microcosm // Y37E11AR.6 // vab-2 /// microcosm // Y38F2AL.3a.2 // vha-11 /// microcosm // Y38H6C.12 // srh-166 /// microcosm // Y39E4B.12c // gly-5 /// microcosm // Y39G10AR.9 // Y39G10AR.9 /// microcosm // Y39G8B.4 // sre-47 /// microcosm // Y40B10A.9 // Y40B10A.9 /// microcosm // Y41C4A.8 // Y41C4A.8 /// microcosm // Y41G9A.10 // Y41G9A.10 /// microcosm // Y42H9AR.3 // rabs-5 /// microcosm // Y43F4A.3 // Y43F4A.3 /// microcosm // Y43F4B.3 // Y43F4B.3 /// microcosm // Y43F8B.10 // Y43F8B.10 /// microcosm // Y45F10A.4 // Y45F10A.4 /// microcosm // Y45F10A.7b // Y45F10A.7 /// microcosm // Y45G5AM.1a.2 // nhr-114 /// microcosm // Y45G5AM.9a // Y45G5AM.9 /// microcosm // Y46H3D.5a.1 // nhr-110 /// microcosm // Y47D7A.2 // Y47D7A.2 /// microcosm // Y47D9A.1a.1 // Y47D9A.1 /// microcosm // Y47D9A.1b // Y47D9A.1 /// microcosm // Y47G6A.18.1 // Y47G6A.18 /// microcosm // Y47H9C.15 // Y47H9C.15 /// microcosm // Y48E1B.16 // Y48E1B.16 /// microcosm // Y49E10.20.1 // Y49E10.20 /// microcosm // Y49E10.20.2 // Y49E10.20 /// microcosm // Y50E8A.16 // haf-7 /// microcosm // Y50E8A.3 // oig-3 /// microcosm // Y51A2D.17 // nhr-70 /// microcosm // Y53F4B.12 // Y53F4B.12 /// microcosm // Y54E10BR.2 // Y54E10BR.2 /// microcosm // Y54F10AM.5.2 // Y54F10AM.5 /// microcosm // Y54G2A.19 // Y54G2A.19 /// microcosm // Y55B1BR.6 // Y55B1BR.6 /// microcosm // Y56A3A.6.1 // Y56A3A.6 /// microcosm // Y56A3A.6.2 // Y56A3A.6 /// microcosm // Y57G11C.42 // Y57G11C.42 /// microcosm // Y59E9AL.7 // Y59E9AL.7 /// microcosm // Y59E9AR.3 // tbx-30 /// microcosm // Y59E9AR.5 // Y59E9AR.5 /// microcosm // Y62H9A.2 // Y62H9A.2 /// microcosm // Y65A5A.1 // Y65A5A.1 /// microcosm // Y65B4A.8.2 // Y65B4A.8 /// microcosm // Y66H1A.4 // Y66H1A.4 /// microcosm // Y6B3A.1a // Y6B3A.1 /// microcosm // Y71D11A.2b // smr-1 /// microcosm // Y71F9AL.9.1 // Y71F9AL.9 /// microcosm // Y71F9AL.9.2 // Y71F9AL.9 /// microcosm // Y71F9AM.4a // cogc-3 /// microcosm // Y71F9AR.2 // Y71F9AR.2 /// microcosm // Y71G12A.2 // Y71G12A.2 /// microcosm // Y71G12A.3 // tag-305 /// microcosm // Y71H10A.2.1 // Y71H10A.2 /// microcosm // Y71H10A.2.2 // Y71H10A.2 /// microcosm // Y71H10A.2.3 // Y71H10A.2 /// microcosm // Y71H10A.2.4 // Y71H10A.2 /// microcosm // Y71H10A.2.5 // Y71H10A.2 /// microcosm // Y73B6BL.20 // Y73B6BL.20 /// microcosm // Y73F8A.11 // Y73F8A.11 /// microcosm // Y73F8A.16 // tbx-39 /// microcosm // Y75B8A.8 // Y75B8A.8 /// microcosm // Y76B12C.1 // Y76B12C.1 /// microcosm // Y79H2A.11 // zyg-8 /// microcosm // Y82E9BR.14a.1 // Y82E9BR.14 /// microcosm // Y82E9BR.14b // Y82E9BR.14 /// microcosm // Y92H12A.2 // Y92H12A.2 /// microcosm // Y92H12A.3 // Y92H12A.3 /// microcosm // Y97E10B.3 // srsx-6 /// microcosm // ZC168.1 // ncx-3 /// microcosm // ZC410.3 // ZC410.3 /// microcosm // ZC449.3a.2 // ZC449.3 /// microcosm // ZC449.3b // ZC449.3 /// microcosm // ZC455.4 // ugt-6 /// microcosm // ZC47.3 // fbxa-29 /// microcosm // ZC513.5 // ZC513.5 /// microcosm // ZC518.1a // ZC518.1 /// microcosm // ZC518.1b // ZC518.1 /// microcosm // ZK1025.2 // ZK1025.2 /// microcosm // ZK1025.8 // ZK1025.8 /// microcosm // ZK1128.7 // ZK1128.7 /// microcosm // ZK177.2 // ZK177.2 /// microcosm // ZK180.2 // ZK180.2 /// microcosm // ZK20.2 // kin-6 /// microcosm // ZK256.1c.2 // pmr-1 /// microcosm // ZK353.3 // ZK353.3 /// microcosm // ZK354.7 // ZK354.7 /// microcosm // ZK370.5.1 // ZK370.5 /// microcosm // ZK484.2b // haf-9 /// microcosm // ZK512.10 // ZK512.10 /// microcosm // ZK512.5.1 // ZK512.5 /// microcosm // ZK512.5.2 // ZK512.5 /// microcosm // ZK546.17.1 // cblc-1 /// microcosm // ZK546.17.2 // cblc-1 /// microcosm // ZK546.1d.1 // zyg-12 /// microcosm // ZK632.12 // ZK632.12 /// microcosm // ZK637.3 // tag-256 /// microcosm // ZK682.7 // ZK682.7 /// microcosm // ZK858.6.1 // ZK858.6 /// microcosm // ZK858.6.2 // ZK858.6 /// microcosm // ZK970.4.2 // vha-9 miRNA-4_0 May 13, 2014 miRBase cel-miR-2-3p
MIMAT0000005_st 20500008 MIMAT0000005 cel-miR-34-5p miRNA Caenorhabditis elegans X:2969802-2969823 (-) 22 AGGCAGUGUGGUUAGCUGGUUG Y41G9A.7 // sense // exon // 1 --- MTI // --- // CELE_Y51A2D.28 /// microcosm // B0035.1a // B0035.1 /// microcosm // B0047.1a // bath-20 /// microcosm // B0213.5 // nlp-30 /// microcosm // B0250.1.2 // rpl-2 /// microcosm // B0261.2a // let-363 /// microcosm // B0261.7 // B0261.7 /// microcosm // B0281.6 // B0281.6 /// microcosm // B0303.3.1 // B0303.3 /// microcosm // B0336.6.2 // B0336.6 /// microcosm // B0361.8.2 // B0361.8 /// microcosm // B0432.13.1 // B0432.13 /// microcosm // B0495.5.2 // B0495.5 /// microcosm // B0545.4 // B0545.4 /// microcosm // C01G5.7 // C01G5.7 /// microcosm // C02B8.2 // C02B8.2 /// microcosm // C02F5.11 // tsp-2 /// microcosm // C04B4.6 // C04B4.6 /// microcosm // C04F12.4.1 // rpl-14 /// microcosm // C04F5.7 // ugt-63 /// microcosm // C04G2.11 // C04G2.11 /// microcosm // C06B8.2a // C06B8.2 /// microcosm // C06E4.2 // C06E4.2 /// microcosm // C06E8.3c // prk-1 /// microcosm // C09G9.4 // tag-19 /// microcosm // C09G9.8 // C09G9.8 /// microcosm // C10G8.2 // C10G8.2 /// microcosm // C13A2.4 // C13A2.4 /// microcosm // C13B9.1.1 // C13B9.1 /// microcosm // C13B9.1.2 // C13B9.1 /// microcosm // C15C8.6 // C15C8.6 /// microcosm // C16C8.17 // C16C8.17 /// microcosm // C16D9.2b // rol-3 /// microcosm // C17A2.1 // nhr-257 /// microcosm // C17C3.18 // ins-13 /// microcosm // C17E4.5 // pab-3 /// microcosm // C17E4.6 // C17E4.6 /// microcosm // C17E7.2 // srh-190 /// microcosm // C17F4.10 // srz-67 /// microcosm // C17H1.6 // C17H1.6 /// microcosm // C18C4.10c.1 // klc-2 /// microcosm // C18C4.10c.2 // klc-2 /// microcosm // C18C4.7 // C18C4.7 /// microcosm // C18E3.7b // ppw-1 /// microcosm // C18F10.6 // srg-3 /// microcosm // C18H7.5 // C18H7.5 /// microcosm // C23H4.2 // C23H4.2 /// microcosm // C24A1.2a // C24A1.2 /// microcosm // C24A1.2b // C24A1.2 /// microcosm // C24F3.1a // C24F3.1 /// microcosm // C24F3.1b.2 // C24F3.1 /// microcosm // C25A1.13 // C25A1.13 /// microcosm // C25A11.4a // ajm-1 /// microcosm // C25A11.4d // ajm-1 /// microcosm // C25B8.5 // C25B8.5 /// microcosm // C25D7.6 // mcm-3 /// microcosm // C25G4.4 // tag-347 /// microcosm // C26D10.5a // eff-1 /// microcosm // C26D10.5b // eff-1 /// microcosm // C26E6.12 // C26E6.12 /// microcosm // C26G2.2 // C26G2.2 /// microcosm // C27A2.6 // dsh-2 /// microcosm // C27B7.1a // spr-2 /// microcosm // C27B7.1b // spr-2 /// microcosm // C28H8.9b // C28H8.9 /// microcosm // C29F4.3 // C29F4.3 /// microcosm // C29F5.4a // mps-1 /// microcosm // C29F9.9 // C29F9.9 /// microcosm // C32D5.11 // C32D5.11 /// microcosm // C32F10.8a.2 // C32F10.8 /// microcosm // C32H11.4 // C32H11.4 /// microcosm // C33A12.10 // sru-4 /// microcosm // C33D9.4 // sru-35 /// microcosm // C34C12.5.1 // C34C12.5 /// microcosm // C34C12.5.2 // C34C12.5 /// microcosm // C37A5.1.1 // C37A5.1 /// microcosm // C38C10.5b // rgr-1 /// microcosm // C38D4.6a.1 // pal-1 /// microcosm // C38D4.6a.2 // pal-1 /// microcosm // C38D4.6b.1 // pal-1 /// microcosm // C38D4.6b.2 // pal-1 /// microcosm // C39B5.5 // C39B5.5 /// microcosm // C39E9.14a.2 // dli-1 /// microcosm // C40A11.4 // C40A11.4 /// microcosm // C40C9.4 // C40C9.4 /// microcosm // C40H1.2 // C40H1.2 /// microcosm // C41A3.2b // C41A3.2 /// microcosm // C41G6.1 // cyp-34A3 /// microcosm // C41G6.11 // sri-24 /// microcosm // C43C3.2 // C43C3.2 /// microcosm // C43E11.8 // exoc-7 /// microcosm // C43H6.5 // C43H6.5 /// microcosm // C43H6.6 // C43H6.6 /// microcosm // C44B12.2 // ost-1 /// microcosm // C44B9.1 // C44B9.1 /// microcosm // C44C10.9 // C44C10.9 /// microcosm // C45B11.1a // pak-2 /// microcosm // C45B11.1b // pak-2 /// microcosm // C45H4.17 // cyp-33C2 /// microcosm // C45H4.3 // srbc-17 /// microcosm // C46C11.1a // C46C11.1 /// microcosm // C46C11.1b // C46C11.1 /// microcosm // C49G7.4 // phat-3 /// microcosm // C50F4.11 // mdf-1 /// microcosm // C52E12.2a.1 // unc-104 /// microcosm // C52E12.2a.2 // unc-104 /// microcosm // C52E2.7 // fbxb-96 /// microcosm // C52E4.4.2 // rpt-1 /// microcosm // C52E4.4.3 // rpt-1 /// microcosm // C53A5.2 // C53A5.2 /// microcosm // C53C11.1 // C53C11.1 /// microcosm // C53C9.3c // kvs-1 /// microcosm // C53H9.2c.1 // C53H9.2 /// microcosm // C53H9.2c.4 // C53H9.2 /// microcosm // C54E4.2a.2 // C54E4.2 /// microcosm // C54E4.2b // C54E4.2 /// microcosm // C54G10.3 // pmp-3 /// microcosm // C55B7.8 // dbr-1 /// microcosm // C55C2.5a // aat-5 /// microcosm // C55C2.5b // aat-5 /// microcosm // C55C3.1 // C55C3.1 /// microcosm // C55C3.5 // C55C3.5 /// microcosm // CD4.8 // CD4.8 /// microcosm // D2005.6 // D2005.6 /// microcosm // D2021.4a // D2021.4 /// microcosm // D2092.4 // D2092.4 /// microcosm // D2096.13 // D2096.13 /// microcosm // D2096.6 // D2096.6 /// microcosm // DY3.2.1 // lmn-1 /// microcosm // DY3.2.2 // lmn-1 /// microcosm // DY3.5 // pqn-26 /// microcosm // E03H4.13 // nhr-89 /// microcosm // E04F6.2 // E04F6.2 /// microcosm // E04F6.5b.1 // E04F6.5 /// microcosm // E04F6.5b.2 // E04F6.5 /// microcosm // F01D4.9 // F01D4.9 /// microcosm // F01G12.5a // let-2 /// microcosm // F01G12.5b.1 // let-2 /// microcosm // F01G12.5b.2 // let-2 /// microcosm // F02E11.4 // F02E11.4 /// microcosm // F07A5.7.2 // unc-15 /// microcosm // F07A5.7.3 // unc-15 /// microcosm // F08F1.3 // F08F1.3 /// microcosm // F09C6.2 // fbxa-44 /// microcosm // F09C6.8 // nhr-262 /// microcosm // F09D12.2 // F09D12.2 /// microcosm // F09F3.10 // nhr-175 /// microcosm // F09G2.6 // ugt-36 /// microcosm // F10A3.5 // str-109 /// microcosm // F10B5.1.2 // rpl-10 /// microcosm // F10B5.8 // F10B5.8 /// microcosm // F10F2.3 // F10F2.3 /// microcosm // F10G8.2 // F10G8.2 /// microcosm // F11A5.9.1 // F11A5.9 /// microcosm // F11A5.9.2 // F11A5.9 /// microcosm // F11E6.3.1 // F11E6.3 /// microcosm // F11E6.3.2 // F11E6.3 /// microcosm // F11E6.8 // F11E6.8 /// microcosm // F12B6.1 // abt-2 /// microcosm // F13E9.16 // F13E9.16 /// microcosm // F13H10.2 // ndx-9 /// microcosm // F14F7.1.1 // col-98 /// microcosm // F14F7.1.3 // col-98 /// microcosm // F14F8.13 // srz-102 /// microcosm // F15A4.9 // F15A4.9 /// microcosm // F17B5.5 // F17B5.5 /// microcosm // F17C11.7a // F17C11.7 /// microcosm // F17C11.7b // F17C11.7 /// microcosm // F18A1.3a.2 // lir-1 /// microcosm // F18A1.3d // lir-1 /// microcosm // F18A1.3e // lir-1 /// microcosm // F18G5.2 // pes-8 /// microcosm // F20B4.3 // F20B4.3 /// microcosm // F20B6.2.3 // vha-12 /// microcosm // F20D1.3.2 // F20D1.3 /// microcosm // F20H11.5 // F20H11.5 /// microcosm // F22B5.1 // evl-20 /// microcosm // F22E10.3 // pgp-14 /// microcosm // F22E5.13 // F22E5.13 /// microcosm // F23H11.7 // F23H11.7 /// microcosm // F25D7.3 // blmp-1 /// microcosm // F25G6.1 // F25G6.1 /// microcosm // F26D10.9.2 // atg-1 /// microcosm // F26D2.12 // F26D2.12 /// microcosm // F26E4.3 // F26E4.3 /// microcosm // F27C8.5 // F27C8.5 /// microcosm // F28A10.2 // F28A10.2 /// microcosm // F28B12.2a // egl-44 /// microcosm // F28B12.2e.2 // egl-44 /// microcosm // F28B12.2f.1 // egl-44 /// microcosm // F28B3.1 // F28B3.1 /// microcosm // F28D1.1.1 // F28D1.1 /// microcosm // F28D9.4 // F28D9.4 /// microcosm // F28E10.4 // F28E10.4 /// microcosm // F28F8.1 // acr-18 /// microcosm // F28F8.5 // F28F8.5 /// microcosm // F28G4.2 // F28G4.2 /// microcosm // F28H6.7 // F28H6.7 /// microcosm // F28H7.6 // F28H7.6 /// microcosm // F28H7.9 // sre-6 /// microcosm // F29G6.1 // F29G6.1 /// microcosm // F30F8.10 // F30F8.10 /// microcosm // F31A9.4 // F31A9.4 /// microcosm // F31F4.2 // srx-23 /// microcosm // F32B4.2 // F32B4.2 /// microcosm // F32E10.6.1 // F32E10.6 /// microcosm // F32E10.6.2 // F32E10.6 /// microcosm // F33D4.3 // flp-13 /// microcosm // F33E11.3 // F33E11.3 /// microcosm // F33H2.2 // F33H2.2 /// microcosm // F35A5.5 // F35A5.5 /// microcosm // F35C11.1 // nlp-5 /// microcosm // F35C11.3 // F35C11.3 /// microcosm // F35C5.8 // clec-65 /// microcosm // F35F11.2 // F35F11.2 /// microcosm // F35G12.4a.2 // F35G12.4 /// microcosm // F36A2.1a.1 // F36A2.1 /// microcosm // F36H1.9 // F36H1.9 /// microcosm // F36H9.8 // F36H9.8 /// microcosm // F37F2.3 // gst-25 /// microcosm // F37H8.3 // F37H8.3 /// microcosm // F38E9.1 // F38E9.1 /// microcosm // F39B2.5.1 // F39B2.5 /// microcosm // F39E9.3 // sri-63 /// microcosm // F40D4.2 // srh-155 /// microcosm // F40D4.8 // srw-51 /// microcosm // F40F12.3 // F40F12.3 /// microcosm // F41C3.2 // F41C3.2 /// microcosm // F41C6.7 // F41C6.7 /// microcosm // F41E6.5 // F41E6.5 /// microcosm // F41H10.11 // sand-1 /// microcosm // F41H10.6a // F41H10.6 /// microcosm // F42C5.10 // F42C5.10 /// microcosm // F42E11.3 // F42E11.3 /// microcosm // F42E8.2 // F42E8.2 /// microcosm // F43D2.3 // F43D2.3 /// microcosm // F43D9.4.1 // sip-1 /// microcosm // F43D9.4.2 // sip-1 /// microcosm // F43D9.4.3 // sip-1 /// microcosm // F43H9.3 // F43H9.3 /// microcosm // F46A9.4 // skr-2 /// microcosm // F46F11.2.1 // cey-2 /// microcosm // F46F11.2.2 // cey-2 /// microcosm // F46F2.3.1 // F46F2.3 /// microcosm // F46F2.3.2 // F46F2.3 /// microcosm // F46F5.9 // F46F5.9 /// microcosm // F46G10.4 // F46G10.4 /// microcosm // F47B7.1.1 // F47B7.1 /// microcosm // F47B7.1.2 // F47B7.1 /// microcosm // F47B7.5 // F47B7.5 /// microcosm // F47B7.6 // F47B7.6 /// microcosm // F47D12.1a // gar-2 /// microcosm // F47D12.1b.1 // gar-2 /// microcosm // F47D12.1b.2 // gar-2 /// microcosm // F47D12.1c // gar-2 /// microcosm // F47D12.1e // gar-2 /// microcosm // F47H4.11 // fbxa-134 /// microcosm // F49A5.3 // clec-22 /// microcosm // F49E11.11 // F49E11.11 /// microcosm // F49E11.2 // F49E11.2 /// microcosm // F49E11.5 // F49E11.5 /// microcosm // F52C12.2 // F52C12.2 /// microcosm // F52E1.2 // F52E1.2 /// microcosm // F52F12.7 // F52F12.7 /// microcosm // F52H2.6 // F52H2.6 /// microcosm // F53A2.6.3 // ife-1 /// microcosm // F53B2.2 // tsp-4 /// microcosm // F53B3.6 // F53B3.6 /// microcosm // F53C3.3 // F53C3.3 /// microcosm // F53C3.5 // F53C3.5 /// microcosm // F53E10.4 // F53E10.4 /// microcosm // F53E10.6.1 // F53E10.6 /// microcosm // F53F1.11 // srd-19 /// microcosm // F53G12.6 // spe-8 /// microcosm // F53H4.6 // F53H4.6 /// microcosm // F53H8.1 // apm-3 /// microcosm // F54B11.5 // F54B11.5 /// microcosm // F54D5.11 // F54D5.11 /// microcosm // F54F3.4 // F54F3.4 /// microcosm // F55A11.7 // F55A11.7 /// microcosm // F55C12.6 // F55C12.6 /// microcosm // F55E10.4 // F55E10.4 /// microcosm // F55G1.6 // F55G1.6 /// microcosm // F55H2.1 // sod-4 /// microcosm // F56A3.3b // npp-6 /// microcosm // F56B6.4a // uvt-5 /// microcosm // F56B6.4b // uvt-5 /// microcosm // F56B6.4c // uvt-5 /// microcosm // F56C9.3 // F56C9.3 /// microcosm // F56F3.3 // F56F3.3 /// microcosm // F56H11.6 // F56H11.6 /// microcosm // F57B9.4d // coq-2 /// microcosm // F57G4.4 // F57G4.4 /// microcosm // F57G8.4 // srw-87 /// microcosm // F57G8.5 // F57G8.5 /// microcosm // F58A3.5 // F58A3.5 /// microcosm // F58G11.6 // F58G11.6 /// microcosm // F58G6.3 // F58G6.3 /// microcosm // F59A1.3 // str-92 /// microcosm // F59D6.1 // F59D6.1 /// microcosm // F59E11.8 // nhr-194 /// microcosm // F59E12.11 // F59E12.11 /// microcosm // H19M22.2a // let-805 /// microcosm // H19M22.2c // let-805 /// microcosm // H28G03.2a // H28G03.2 /// microcosm // H28G03.6 // mtm-5 /// microcosm // H43I07.1 // H43I07.1 /// microcosm // K01A2.1 // sgcb-1 /// microcosm // K04A8.2 // K04A8.2 /// microcosm // K04F10.3 // K04F10.3 /// microcosm // K04F10.4e // bli-4 /// microcosm // K05B2.5a.2 // pes-22 /// microcosm // K07C11.9 // cogc-6 /// microcosm // K07D4.3.1 // rpn-11 /// microcosm // K08C9.1 // K08C9.1 /// microcosm // K08D10.9 // K08D10.9 /// microcosm // K08D8.1 // K08D8.1 /// microcosm // K08E3.1 // tyr-2 /// microcosm // K08F4.8 // msp-38 /// microcosm // K08H10.4.1 // uda-1 /// microcosm // K08H10.4.2 // uda-1 /// microcosm // K08H2.1 // skr-21 /// microcosm // K09A11.2 // cyp-14A1 /// microcosm // K09C4.5 // K09C4.5 /// microcosm // K09C8.3 // nas-10 /// microcosm // K09D9.8 // srh-8 /// microcosm // K10B4.3 // K10B4.3 /// microcosm // K10G4.5 // K10G4.5 /// microcosm // K11C4.3b // unc-70 /// microcosm // K11G9.5 // K11G9.5 /// microcosm // K12D12.1 // K12D12.1 /// microcosm // K12D12.4a // K12D12.4 /// microcosm // K12D9.1 // K12D9.1 /// microcosm // K12H6.9 // K12H6.9 /// microcosm // M01E11.4c // pqn-52 /// microcosm // M01F1.4a // M01F1.4 /// microcosm // M01F1.4b // M01F1.4 /// microcosm // M01G12.2 // M01G12.2 /// microcosm // M01H9.5 // M01H9.5 /// microcosm // M04B2.3 // gfl-1 /// microcosm // M176.5 // M176.5 /// microcosm // M176.8 // M176.8 /// microcosm // M7.13 // str-3 /// microcosm // PAR2.1.2 // PAR2.1 /// microcosm // R02D5.7 // R02D5.7 /// microcosm // R03H10.2 // R03H10.2 /// microcosm // R04D3.3.1 // R04D3.3 /// microcosm // R04D3.3.2 // R04D3.3 /// microcosm // R05G9.1 // R05G9.1 /// microcosm // R05H11.1 // R05H11.1 /// microcosm // R08C7.3.1 // htz-1 /// microcosm // R08C7.3.2 // htz-1 /// microcosm // R08C7.3.3 // htz-1 /// microcosm // R09A8.2 // R09A8.2 /// microcosm // R102.10 // R102.10 /// microcosm // R102.4a // R102.4 /// microcosm // R11D1.8.1 // rpl-28 /// microcosm // R12B2.8 // R12B2.8 /// microcosm // R13G10.2 // amx-1 /// microcosm // R74.5b.1 // asd-1 /// microcosm // T01B6.1 // T01B6.1 /// microcosm // T01D1.1 // T01D1.1 /// microcosm // T01E8.4 // T01E8.4 /// microcosm // T01G6.1 // T01G6.1 /// microcosm // T01H3.1.2 // vha-4 /// microcosm // T02H6.10 // T02H6.10 /// microcosm // T02H6.1b // T02H6.1 /// microcosm // T03D3.11 // srj-44 /// microcosm // T03D8.6.2 // T03D8.6 /// microcosm // T03F7.1.1 // snf-11 /// microcosm // T04B2.3b // T04B2.3 /// microcosm // T04F3.3 // T04F3.3 /// microcosm // T04H1.2.2 // T04H1.2 /// microcosm // T05A6.1 // cki-1 /// microcosm // T05C12.6a // mig-5 /// microcosm // T06C12.14 // T06C12.14 /// microcosm // T06D8.7.1 // T06D8.7 /// microcosm // T06D8.7.2 // T06D8.7 /// microcosm // T06D8.8.1 // rpn-9 /// microcosm // T06D8.8.2 // rpn-9 /// microcosm // T07C12.14 // T07C12.14 /// microcosm // T08A9.4 // T08A9.4 /// microcosm // T08H4.1 // tag-127 /// microcosm // T09B4.3 // T09B4.3 /// microcosm // T09F5.2 // T09F5.2 /// microcosm // T10H10.1 // hum-6 /// microcosm // T11G6.3 // T11G6.3 /// microcosm // T12A2.5 // T12A2.5 /// microcosm // T12A7.3 // T12A7.3 /// microcosm // T12D8.1 // tag-350 /// microcosm // T13C2.4 // T13C2.4 /// microcosm // T14A8.2a // T14A8.2 /// microcosm // T14E8.2 // T14E8.2 /// microcosm // T14F9.4a.2 // peb-1 /// microcosm // T16A1.7 // pqn-66 /// microcosm // T16G1.9 // T16G1.9 /// microcosm // T20B5.2 // T20B5.2 /// microcosm // T20B6.1 // T20B6.1 /// microcosm // T20D4.19 // T20D4.19 /// microcosm // T20D4.3 // T20D4.3 /// microcosm // T22E5.3 // T22E5.3 /// microcosm // T22F7.3 // T22F7.3 /// microcosm // T23E7.2b // T23E7.2 /// microcosm // T23E7.2c // T23E7.2 /// microcosm // T23E7.2d // T23E7.2 /// microcosm // T23F11.6 // T23F11.6 /// microcosm // T23G5.2a.1 // T23G5.2 /// microcosm // T24H7.5b // tat-4 /// microcosm // T24H7.5c.1 // tat-4 /// microcosm // T26A5.1 // tag-200 /// microcosm // T26G10.1 // T26G10.1 /// microcosm // T27C10.3 // T27C10.3 /// microcosm // T27F6.1 // T27F6.1 /// microcosm // T27F6.6.2 // T27F6.6 /// microcosm // T28D6.7 // T28D6.7 /// microcosm // T28D9.11 // T28D9.11 /// microcosm // T28F2.2 // T28F2.2 /// microcosm // W02D3.6 // tag-194 /// microcosm // W02G9.5 // W02G9.5 /// microcosm // W03B1.5 // W03B1.5 /// microcosm // W03B1.9 // W03B1.9 /// microcosm // W03D2.2 // fbxb-55 /// microcosm // W03D2.9 // W03D2.9 /// microcosm // W03F8.4 // W03F8.4 /// microcosm // W03G11.2 // W03G11.2 /// microcosm // W04A4.3 // W04A4.3 /// microcosm // W04A8.3 // W04A8.3 /// microcosm // W04G5.6 // kin-23 /// microcosm // W05H5.2 // W05H5.2 /// microcosm // W06D12.2 // twk-42 /// microcosm // W06F12.2a // W06F12.2 /// microcosm // W06F12.2b // W06F12.2 /// microcosm // W06F12.2c // W06F12.2 /// microcosm // W07G9.2 // W07G9.2 /// microcosm // W08E12.7.1 // W08E12.7 /// microcosm // W08E12.7.2 // W08E12.7 /// microcosm // W08F4.12 // W08F4.12 /// microcosm // W10C8.5.3 // W10C8.5 /// microcosm // Y102A5B.3 // clec-37 /// microcosm // Y105C5A.26 // Y105C5A.26 /// microcosm // Y105C5B.20 // Y105C5B.20 /// microcosm // Y105E8A.24a // Y105E8A.24 /// microcosm // Y105E8B.9 // Y105E8B.9 /// microcosm // Y106G6D.3 // Y106G6D.3 /// microcosm // Y110A2AL.4a // Y110A2AL.4 /// microcosm // Y110A2AL.4b // Y110A2AL.4 /// microcosm // Y113G7A.13 // Y113G7A.13 /// microcosm // Y116A8C.18 // nhr-229 /// microcosm // Y17G9A.6 // str-175 /// microcosm // Y18D10A.20.1 // pfn-1 /// microcosm // Y23B4A.1 // Y23B4A.1 /// microcosm // Y23H5B.1 // Y23H5B.1 /// microcosm // Y25C1A.1 // Y25C1A.1 /// microcosm // Y32F6A.1.2 // Y32F6A.1 /// microcosm // Y32G9A.8 // Y32G9A.8 /// microcosm // Y32H12A.7.3 // Y32H12A.7 /// microcosm // Y37E11B.2 // Y37E11B.2 /// microcosm // Y38A10A.7 // Y38A10A.7 /// microcosm // Y38E10A.10 // Y38E10A.10 /// microcosm // Y38E10A.14 // Y38E10A.14 /// microcosm // Y38H6C.16 // Y38H6C.16 /// microcosm // Y38H6C.22 // abf-4 /// microcosm // Y38H6C.5 // Y38H6C.5 /// microcosm // Y39B6A.23 // Y39B6A.23 /// microcosm // Y39C12A.1 // Y39C12A.1 /// microcosm // Y39G8B.9 // Y39G8B.9 /// microcosm // Y39H10A.7a // chk-1 /// microcosm // Y39H10A.7b.2 // chk-1 /// microcosm // Y40D12A.1a // Y40D12A.1 /// microcosm // Y41D4A.3 // Y41D4A.3 /// microcosm // Y41D4B.1 // Y41D4B.1 /// microcosm // Y41D4B.17 // Y41D4B.17 /// microcosm // Y41G9A.1 // osm-5 /// microcosm // Y43B11AL.1 // Y43B11AL.1 /// microcosm // Y43F11A.1 // Y43F11A.1 /// microcosm // Y43F11A.4 // Y43F11A.4 /// microcosm // Y43F8B.1a.1 // Y43F8B.1 /// microcosm // Y44A6B.2 // srxa-15 /// microcosm // Y45F10B.1 // tsp-5 /// microcosm // Y47D7A.6 // Y47D7A.6 /// microcosm // Y47G6A.7b.2 // Y47G6A.7 /// microcosm // Y47G7B.3 // sri-60 /// microcosm // Y48B6A.14.1 // hmg-1.1 /// microcosm // Y48B6A.14.3 // hmg-1.1 /// microcosm // Y48G1C.2.3 // csk-1 /// microcosm // Y50D4A.3 // Y50D4A.3 /// microcosm // Y51H7C.13 // Y51H7C.13 /// microcosm // Y54E10BR.2 // Y54E10BR.2 /// microcosm // Y54F10AM.4a // ceh-44 /// microcosm // Y54G2A.12 // Y54G2A.12 /// microcosm // Y54G2A.27 // Y54G2A.27 /// microcosm // Y54G9A.4 // Y54G9A.4 /// microcosm // Y55D5A.3 // Y55D5A.3 /// microcosm // Y57A10C.1 // Y57A10C.1 /// microcosm // Y57G11C.24a.1 // eps-8 /// microcosm // Y57G11C.24g // eps-8 /// microcosm // Y57G11C.51 // Y57G11C.51 /// microcosm // Y57G11C.6 // Y57G11C.6 /// microcosm // Y59E1B.1 // Y59E1B.1 /// microcosm // Y5H2B.6 // cyp-33C12 /// microcosm // Y60A3A.3 // srh-183 /// microcosm // Y60A9.3 // Y60A9.3 /// microcosm // Y63D3A.10 // fbxb-56 /// microcosm // Y67A10A.2 // Y67A10A.2 /// microcosm // Y67D8C.8 // cpg-9 /// microcosm // Y69H2.6 // ubc-19 /// microcosm // Y6D1A.2 // Y6D1A.2 /// microcosm // Y6E2A.8 // Y6E2A.8 /// microcosm // Y70C5C.3 // Y70C5C.3 /// microcosm // Y71F9AL.18.2 // pme-1 /// microcosm // Y71F9AR.2 // Y71F9AR.2 /// microcosm // Y73B3A.12 // Y73B3A.12 /// microcosm // Y73B3A.20 // Y73B3A.20 /// microcosm // Y73B6BL.16 // Y73B6BL.16 /// microcosm // Y76A2B.5 // Y76A2B.5 /// microcosm // Y79H2A.12 // Y79H2A.12 /// microcosm // Y7A5A.6 // Y7A5A.6 /// microcosm // Y80D3A.10 // nlp-42 /// microcosm // Y81B9A.4 // Y81B9A.4 /// microcosm // Y82E9BR.12 // fbxa-138 /// microcosm // Y82E9BR.21 // Y82E9BR.21 /// microcosm // Y97E10C.1.1 // Y97E10C.1 /// microcosm // Y9C9A.9 // str-158 /// microcosm // ZC101.2b // unc-52 /// microcosm // ZC116.1 // ZC116.1 /// microcosm // ZC168.4.2 // cyb-1 /// microcosm // ZC168.4.4 // cyb-1 /// microcosm // ZC204.12 // ZC204.12 /// microcosm // ZC266.1 // ZC266.1 /// microcosm // ZC373.6 // dao-4 /// microcosm // ZC404.5 // srh-28 /// microcosm // ZC8.4a // lfi-1 /// microcosm // ZC8.4b // lfi-1 /// microcosm // ZC8.4d // lfi-1 /// microcosm // ZK1058.1.1 // mmcm-1 /// microcosm // ZK1058.2.1 // pat-3 /// microcosm // ZK1058.2.2 // pat-3 /// microcosm // ZK1128.2b // ZK1128.2 /// microcosm // ZK1151.1a // vab-10 /// microcosm // ZK1151.1e // vab-10 /// microcosm // ZK1151.1h // vab-10 /// microcosm // ZK1236.6 // pqn-96 /// microcosm // ZK1248.13 // ZK1248.13 /// microcosm // ZK1248.7 // ZK1248.7 /// microcosm // ZK177.8a // ZK177.8 /// microcosm // ZK20.2 // kin-6 /// microcosm // ZK262.11 // srh-209 /// microcosm // ZK353.3 // ZK353.3 /// microcosm // ZK354.4 // msp-113 /// microcosm // ZK377.1 // wrt-6 /// microcosm // ZK381.5a // ZK381.5 /// microcosm // ZK381.5b // ZK381.5 /// microcosm // ZK418.10 // ZK418.10 /// microcosm // ZK546.6 // msp-152 /// microcosm // ZK617.3 // spe-17 /// microcosm // ZK686.1 // ZK686.1 /// microcosm // ZK809.7 // prx-2 /// microcosm // ZK829.8 // srj-1 /// microcosm // ZK892.1a // lec-3 /// microcosm // ZK892.3 // ZK892.3 /// microcosm // ZK896.9 // ZK896.9 /// microcosm // ZK930.2 // ZK930.2 /// microcosm // ZK938.4 // ZK938.4 /// microcosm // ZK970.3 // mdt-22 /// microcosm // ZK973.11 // ZK973.11 miRNA-4_0 May 13, 2014 miRBase cel-miR-34-5p
MIMAT0015093_st 20500009 MIMAT0015093 cel-miR-34-3p miRNA Caenorhabditis elegans X:2969765-2969786 (-) 22 ACGGCUACCUUCACUGCCACCC Y41G9A.7 // sense // exon // 1 --- --- miRNA-4_0 May 13, 2014 miRBase cel-miR-34-3p
MIMAT0020303_st 20500010 MIMAT0020303 cel-miR-35-5p miRNA Caenorhabditis elegans II:11537565-11537587 (+) 23 UGCUGGUUUCUUCCACAGUGGUA Y62F5A.16 // sense // exon // 1 /// Y62F5A.2 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) --- miRNA-4_0 May 13, 2014 miRBase cel-miR-35-5p
MIMAT0000006_st 20500011 MIMAT0000006 cel-miR-35-3p miRNA Caenorhabditis elegans II:11537604-11537625 (+) 22 UCACCGGGUGGAAACUAGCAGU Y62F5A.16 // sense // exon // 1 /// Y62F5A.2 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) MTI // --- // W06H8.5 /// microcosm // 4R79.1b // nas-6 /// microcosm // 6R55.2 // 6R55.2 /// microcosm // AH10.4 // AH10.4 /// microcosm // B0034.2 // B0034.2 /// microcosm // B0035.3 // B0035.3 /// microcosm // B0047.1a // bath-20 /// microcosm // B0047.2 // B0047.2 /// microcosm // B0284.1 // B0284.1 /// microcosm // B0336.1.1 // wrm-1 /// microcosm // B0336.1.2 // wrm-1 /// microcosm // B0399.1b // B0399.1 /// microcosm // B0399.1c // B0399.1 /// microcosm // B0403.3 // B0403.3 /// microcosm // B0416.1 // B0416.1 /// microcosm // B0432.1 // B0432.1 /// microcosm // B0491.8a // clh-2 /// microcosm // B0491.8b // clh-2 /// microcosm // B0491.8c // clh-2 /// microcosm // B0496.5 // B0496.5 /// microcosm // C01B4.6 // C01B4.6 /// microcosm // C01G10.12 // dnj-3 /// microcosm // C01G5.7 // C01G5.7 /// microcosm // C02B8.2 // C02B8.2 /// microcosm // C03C10.4 // C03C10.4 /// microcosm // C03C11.1 // C03C11.1 /// microcosm // C03E10.4 // gly-20 /// microcosm // C03G6.5 // C03G6.5 /// microcosm // C04C11.2.1 // C04C11.2 /// microcosm // C04C11.2.2 // C04C11.2 /// microcosm // C04F5.1 // sid-1 /// microcosm // C05E4.11 // srj-24 /// microcosm // C06E1.3 // C06E1.3 /// microcosm // C06E7.2.1 // C06E7.2 /// microcosm // C06E7.2.2 // C06E7.2 /// microcosm // C06E7.6 // spe-27 /// microcosm // C07H6.6 // clk-2 /// microcosm // C08E3.12 // C08E3.12 /// microcosm // C08F8.2a // C08F8.2 /// microcosm // C08F8.2b.1 // C08F8.2 /// microcosm // C09G1.2 // C09G1.2 /// microcosm // C09G12.3 // srz-78 /// microcosm // C13F10.1b // C13F10.1 /// microcosm // C14F5.5 // sem-5 /// microcosm // C15A11.1 // col-35 /// microcosm // C15C7.6 // C15C7.6 /// microcosm // C15H9.2 // C15H9.2 /// microcosm // C16C2.2a.1 // eat-16 /// microcosm // C17E7.2 // srh-190 /// microcosm // C18E9.10 // C18E9.10 /// microcosm // C18F3.2d // sax-7 /// microcosm // C23F12.2 // flna-2 /// microcosm // C23H5.8b.1 // C23H5.8 /// microcosm // C24B9.6 // srt-27 /// microcosm // C24H10.5 // uvt-2 /// microcosm // C25H3.12 // C25H3.12 /// microcosm // C27A2.2a.3 // rpl-22 /// microcosm // C27D6.3 // C27D6.3 /// microcosm // C29F9.5 // C29F9.5 /// microcosm // C29G2.3 // C29G2.3 /// microcosm // C30B5.2a // C30B5.2 /// microcosm // C30B5.2b // C30B5.2 /// microcosm // C30F12.2.1 // C30F12.2 /// microcosm // C30F12.2.2 // C30F12.2 /// microcosm // C30F12.5 // C30F12.5 /// microcosm // C30G7.2 // C30G7.2 /// microcosm // C31E10.8 // C31E10.8 /// microcosm // C32E12.1 // C32E12.1 /// microcosm // C32F10.1a.1 // obr-4 /// microcosm // C32F10.1a.2 // obr-4 /// microcosm // C34B2.4 // C34B2.4 /// microcosm // C34D4.4a // C34D4.4 /// microcosm // C34F11.3b // C34F11.3 /// microcosm // C34F11.9b // dsh-1 /// microcosm // C34F6.11 // C34F6.11 /// microcosm // C34G6.1 // C34G6.1 /// microcosm // C35B1.1.1 // ubc-1 /// microcosm // C36A4.2 // cyp-25A2 /// microcosm // C36B1.5.2 // C36B1.5 /// microcosm // C36E8.2 // C36E8.2 /// microcosm // C38C3.4a // C38C3.4 /// microcosm // C39D10.11 // C39D10.11 /// microcosm // C41A3.1 // C41A3.1 /// microcosm // C41D11.2 // eif-3.H /// microcosm // C41D11.8.1 // cps-6 /// microcosm // C41D11.8.2 // cps-6 /// microcosm // C44C1.5b.2 // C44C1.5 /// microcosm // C44E4.3 // C44E4.3 /// microcosm // C44F1.5 // acy-3 /// microcosm // C45G9.2 // C45G9.2 /// microcosm // C48D1.3 // cho-1 /// microcosm // C48D5.3 // C48D5.3 /// microcosm // C50B8.5 // C50B8.5 /// microcosm // C50F4.1.1 // C50F4.1 /// microcosm // C51E3.7a.1 // egl-3 /// microcosm // C51E3.7b.2 // egl-3 /// microcosm // C52E12.2a.1 // unc-104 /// microcosm // C52E12.2a.2 // unc-104 /// microcosm // C53B7.6 // C53B7.6 /// microcosm // C54F6.12 // C54F6.12 /// microcosm // C55A6.11 // C55A6.11 /// microcosm // C56A3.7 // cav-2 /// microcosm // C56G2.9 // C56G2.9 /// microcosm // D1046.5 // D1046.5 /// microcosm // D1053.2 // D1053.2 /// microcosm // D1081.3 // D1081.3 /// microcosm // D2024.10 // D2024.10 /// microcosm // D2024.2 // D2024.2 /// microcosm // D2096.8 // D2096.8 /// microcosm // DH11.4 // DH11.4 /// microcosm // E02A10.3 // E02A10.3 /// microcosm // E02C12.3 // srx-47 /// microcosm // E04F6.11a // clh-3 /// microcosm // F01E11.5a // tyra-2 /// microcosm // F01F1.13 // F01F1.13 /// microcosm // F07A11.1 // F07A11.1 /// microcosm // F07C6.4b.1 // F07C6.4 /// microcosm // F07C6.4b.2 // F07C6.4 /// microcosm // F07C6.4c.2 // F07C6.4 /// microcosm // F07F6.1 // F07F6.1 /// microcosm // F10E7.1 // F10E7.1 /// microcosm // F10E9.1 // F10E9.1 /// microcosm // F10G7.12 // F10G7.12 /// microcosm // F10G7.2.2 // tsn-1 /// microcosm // F10G7.6 // F10G7.6 /// microcosm // F10G7.9a // F10G7.9 /// microcosm // F10G7.9b.1 // F10G7.9 /// microcosm // F12A10.5 // F12A10.5 /// microcosm // F12A10.6 // F12A10.6 /// microcosm // F12F6.10 // --- /// microcosm // F13A2.8 // nhr-118 /// microcosm // F13A7.13 // sre-36 /// microcosm // F13D12.8 // F13D12.8 /// microcosm // F14F8.9 // F14F8.9 /// microcosm // F15D3.2 // F15D3.2 /// microcosm // F15D3.8 // F15D3.8 /// microcosm // F15H9.4 // sri-16 /// microcosm // F16D3.7 // F16D3.7 /// microcosm // F16H6.4 // F16H6.4 /// microcosm // F16H6.5 // F16H6.5 /// microcosm // F17C11.5 // F17C11.5 /// microcosm // F17C11.9b.1 // F17C11.9 /// microcosm // F17C11.9c.2 // F17C11.9 /// microcosm // F17C8.3 // F17C8.3 /// microcosm // F19D8.2 // F19D8.2 /// microcosm // F19G12.2 // F19G12.2 /// microcosm // F19H8.4 // F19H8.4 /// microcosm // F20B6.6 // F20B6.6 /// microcosm // F20D6.5 // F20D6.5 /// microcosm // F21H12.3 // F21H12.3 /// microcosm // F22B5.9.1 // frs-2 /// microcosm // F22B5.9.2 // frs-2 /// microcosm // F22D6.2.1 // F22D6.2 /// microcosm // F22D6.2.2 // F22D6.2 /// microcosm // F23B12.9 // egl-1 /// microcosm // F23H12.1 // snb-2 /// microcosm // F25B3.1 // F25B3.1 /// microcosm // F25D1.4 // F25D1.4 /// microcosm // F25H2.5.4 // F25H2.5 /// microcosm // F25H2.5.5 // F25H2.5 /// microcosm // F25H2.5.6 // F25H2.5 /// microcosm // F25H9.3 // F25H9.3 /// microcosm // F26F4.7 // nhl-2 /// microcosm // F26H9.2 // F26H9.2 /// microcosm // F27E5.5 // F27E5.5 /// microcosm // F29B9.8.1 // F29B9.8 /// microcosm // F29B9.8.2 // F29B9.8 /// microcosm // F31A9.4 // F31A9.4 /// microcosm // F31D5.2 // F31D5.2 /// microcosm // F31F4.4 // srx-21 /// microcosm // F32D8.1 // F32D8.1 /// microcosm // F32E10.8 // F32E10.8 /// microcosm // F35D11.3.1 // F35D11.3 /// microcosm // F35D11.3.2 // F35D11.3 /// microcosm // F35D6.1a // fem-1 /// microcosm // F35E12.4 // F35E12.4 /// microcosm // F35F10.7 // F35F10.7 /// microcosm // F35G12.2.4 // F35G12.2 /// microcosm // F35H10.4.1 // vha-5 /// microcosm // F35H10.4.2 // vha-5 /// microcosm // F36D4.4 // F36D4.4 /// microcosm // F36G9.5 // sru-22 /// microcosm // F36H5.10 // F36H5.10 /// microcosm // F36H5.9 // F36H5.9 /// microcosm // F37B4.1 // srh-127 /// microcosm // F38E11.7 // wrt-3 /// microcosm // F38H12.3 // nhr-181 /// microcosm // F38H12.5 // F38H12.5 /// microcosm // F39E9.7 // F39E9.7 /// microcosm // F39H11.5.1 // pbs-7 /// microcosm // F40A3.6 // F40A3.6 /// microcosm // F40D4.7 // srbc-26 /// microcosm // F40F12.3 // F40F12.3 /// microcosm // F40F9.8 // F40F9.8 /// microcosm // F40G9.14 // F40G9.14 /// microcosm // F41B4.1 // F41B4.1 /// microcosm // F41D3.10 // F41D3.10 /// microcosm // F41D3.5 // F41D3.5 /// microcosm // F41D3.6 // F41D3.6 /// microcosm // F41D3.7 // F41D3.7 /// microcosm // F41G4.7 // F41G4.7 /// microcosm // F42G9.9d.1 // ptl-1 /// microcosm // F42G9.9d.2 // ptl-1 /// microcosm // F44B9.8 // F44B9.8 /// microcosm // F44C8.5b // nhr-128 /// microcosm // F45E12.5a // F45E12.5 /// microcosm // F45G2.1 // nas-1 /// microcosm // F45H7.2b // gei-1 /// microcosm // F46A8.5 // F46A8.5 /// microcosm // F46A8.8 // F46A8.8 /// microcosm // F46F5.15 // F46F5.15 /// microcosm // F47B10.6 // F47B10.6 /// microcosm // F47G4.3 // gpdh-1 /// microcosm // F47G6.2 // F47G6.2 /// microcosm // F47G9.3 // F47G9.3 /// microcosm // F48B9.3 // F48B9.3 /// microcosm // F48G7.12 // F48G7.12 /// microcosm // F49E11.2 // F49E11.2 /// microcosm // F49F1.7 // F49F1.7 /// microcosm // F52D2.7.2 // F52D2.7 /// microcosm // F52F10.4 // F52F10.4 /// microcosm // F52F12.6 // ekl-2 /// microcosm // F53A9.10b.3 // tnt-2 /// microcosm // F53A9.10b.4 // tnt-2 /// microcosm // F53B1.9 // F53B1.9 /// microcosm // F53E10.4 // F53E10.4 /// microcosm // F53G2.4b // pqn-42 /// microcosm // F54C8.1 // F54C8.1 /// microcosm // F54E7.5 // sdz-21 /// microcosm // F54F3.4 // F54F3.4 /// microcosm // F55A4.8a // F55A4.8 /// microcosm // F56F3.5.2 // rps-1 /// microcosm // F57B10.7 // tre-1 /// microcosm // F57B7.2 // F57B7.2 /// microcosm // F57C7.2a // nhx-5 /// microcosm // F57C7.2b // nhx-5 /// microcosm // F58E10.1a // F58E10.1 /// microcosm // F58F6.1 // col-104 /// microcosm // F58G6.2 // srm-3 /// microcosm // F59A7.3 // srab-13 /// microcosm // F59C6.3 // F59C6.3 /// microcosm // F59D6.3 // F59D6.3 /// microcosm // F59E12.5a.1 // npl-4.2 /// microcosm // F59E12.5a.2 // npl-4.2 /// microcosm // F59E12.5b // npl-4.2 /// microcosm // H05C05.1a // H05C05.1 /// microcosm // H06A10.1 // H06A10.1 /// microcosm // H06H21.3.1 // H06H21.3 /// microcosm // H06H21.3.2 // H06H21.3 /// microcosm // H09F14.1 // H09F14.1 /// microcosm // H09I01.1 // H09I01.1 /// microcosm // H10E21.5 // H10E21.5 /// microcosm // H19M22.2a // let-805 /// microcosm // H19M22.2c // let-805 /// microcosm // H20J04.9 // H20J04.9 /// microcosm // H21P03.1 // mbf-1 /// microcosm // H28G03.6 // mtm-5 /// microcosm // K02B12.7 // K02B12.7 /// microcosm // K02E7.9 // K02E7.9 /// microcosm // K02F2.6 // ser-3 /// microcosm // K03B8.11 // K03B8.11 /// microcosm // K03D3.1 // srz-74 /// microcosm // K03E6.1 // lim-6 /// microcosm // K04F10.4f // bli-4 /// microcosm // K04G11.5 // irk-3 /// microcosm // K07B1.3 // ucp-4 /// microcosm // K07H8.8 // K07H8.8 /// microcosm // K07H8.9 // K07H8.9 /// microcosm // K08A2.5c.2 // nhr-88 /// microcosm // K08B4.5 // K08B4.5 /// microcosm // K08E5.2b.3 // nac-3 /// microcosm // K08F11.5.1 // K08F11.5 /// microcosm // K08F11.5.2 // K08F11.5 /// microcosm // K08F4.3 // K08F4.3 /// microcosm // K08F9.2.3 // tag-216 /// microcosm // K09D9.13 // srw-89 /// microcosm // K09F6.10 // K09F6.10 /// microcosm // K10C2.6 // K10C2.6 /// microcosm // K11D2.1 // K11D2.1 /// microcosm // K12D12.4a // K12D12.4 /// microcosm // K12D9.9 // srw-112 /// microcosm // K12H4.7b.2 // K12H4.7 /// microcosm // K12H6.12 // K12H6.12 /// microcosm // M01D1.2b // math-34 /// microcosm // M01D1.9 // fbxb-40 /// microcosm // M01F1.4a // M01F1.4 /// microcosm // M01F1.4b // M01F1.4 /// microcosm // M03F8.1 // M03F8.1 /// microcosm // M04B2.7 // M04B2.7 /// microcosm // M05D6.9 // M05D6.9 /// microcosm // R03G8.1 // R03G8.1 /// microcosm // R05H11.2 // R05H11.2 /// microcosm // R08C7.12.1 // R08C7.12 /// microcosm // R08C7.12.2 // R08C7.12 /// microcosm // R08E5.4 // R08E5.4 /// microcosm // R09B3.1b // exo-3 /// microcosm // R10D12.10 // R10D12.10 /// microcosm // R10E4.2a.1 // tag-310 /// microcosm // R10F2.4 // R10F2.4 /// microcosm // R11G11.3 // R11G11.3 /// microcosm // R11G11.5 // srw-108 /// microcosm // R11H6.1.1 // pes-9 /// microcosm // R11H6.1.2 // pes-9 /// microcosm // R11H6.1.3 // pes-9 /// microcosm // R12E2.2.1 // R12E2.2 /// microcosm // R12E2.2.2 // R12E2.2 /// microcosm // R12E2.3.2 // rpn-8 /// microcosm // R13D7.4 // srx-60 /// microcosm // R13F6.4a // ten-1 /// microcosm // R13H8.1e.1 // daf-16 /// microcosm // R148.3a // R148.3 /// microcosm // R151.5b // dpy-31 /// microcosm // R160.5 // R160.5 /// microcosm // R74.3b.1 // xbp-1 /// microcosm // R74.3b.2 // xbp-1 /// microcosm // T01B7.5b // T01B7.5 /// microcosm // T03D8.4 // grl-14 /// microcosm // T03F6.5 // lis-1 /// microcosm // T04B8.1 // T04B8.1 /// microcosm // T04C12.7 // T04C12.7 /// microcosm // T04F3.2 // T04F3.2 /// microcosm // T04G9.6 // T04G9.6 /// microcosm // T04H1.3 // T04H1.3 /// microcosm // T04H1.7 // ugt-55 /// microcosm // T05C1.4a // T05C1.4 /// microcosm // T05C1.4b // T05C1.4 /// microcosm // T05C1.4c // T05C1.4 /// microcosm // T05E11.1.1 // rps-5 /// microcosm // T05E11.1.2 // rps-5 /// microcosm // T05F1.5 // T05F1.5 /// microcosm // T05H4.6.3 // T05H4.6a /// microcosm // T06E4.5 // T06E4.5 /// microcosm // T07F8.3b.1 // gld-3 /// microcosm // T07G12.1 // cal-4 /// microcosm // T07G12.4 // T07G12.4 /// microcosm // T07G12.8 // T07G12.8 /// microcosm // T09F5.5 // srh-55 /// microcosm // T10B10.3.2 // T10B10.3 /// microcosm // T11F9.14 // T11F9.14 /// microcosm // T11F9.2b // tag-140 /// microcosm // T12F5.4 // lin-59 /// microcosm // T13C5.5a // bca-1 /// microcosm // T13C5.5b.1 // bca-1 /// microcosm // T13G4.3 // T13G4.3 /// microcosm // T13H5.3 // T13H5.3 /// microcosm // T14B1.2 // T14B1.2 /// microcosm // T14E8.2 // T14E8.2 /// microcosm // T15D6.7 // T15D6.7 /// microcosm // T16H12.9 // T16H12.9 /// microcosm // T17E9.2a // T17E9.2 /// microcosm // T17H7.4g.1 // gei-16 /// microcosm // T17H7.4k.2 // gei-16 /// microcosm // T18D3.6 // T18D3.6 /// microcosm // T19B10.1 // cyp-29A2 /// microcosm // T19C3.8 // fem-2 /// microcosm // T20B12.1 // T20B12.1 /// microcosm // T20F7.5 // T20F7.5 /// microcosm // T22A3.3a // lst-1 /// microcosm // T22C1.3 // T22C1.3 /// microcosm // T22F3.6 // srh-212 /// microcosm // T22H2.5a.2 // plsc-2 /// microcosm // T23B12.11 // T23B12.11 /// microcosm // T23G5.2b.2 // T23G5.2 /// microcosm // T24A11.3 // toh-1 /// microcosm // T26A5.6.1 // T26A5.6 /// microcosm // T26A5.6.2 // T26A5.6 /// microcosm // T26A8.1.1 // T26A8.1 /// microcosm // T26A8.1.2 // T26A8.1 /// microcosm // T26A8.1.3 // T26A8.1 /// microcosm // T26C11.5 // ceh-41 /// microcosm // T26C11.8 // T26C11.8 /// microcosm // T26E3.10 // T26E3.10 /// microcosm // T27E7.1 // T27E7.1 /// microcosm // T28D6.5a // T28D6.5 /// microcosm // T28D6.5b // T28D6.5 /// microcosm // T28F2.2 // T28F2.2 /// microcosm // T28H10.4 // T28H10.4 /// microcosm // W01A8.8 // W01A8.8 /// microcosm // W01C9.4 // W01C9.4 /// microcosm // W02D7.9 // W02D7.9 /// microcosm // W03D2.9 // W03D2.9 /// microcosm // W03F8.10 // W03F8.10 /// microcosm // W03G11.2 // W03G11.2 /// microcosm // W08F4.3.1 // W08F4.3 /// microcosm // W08F4.3.2 // W08F4.3 /// microcosm // W09D6.4 // W09D6.4 /// microcosm // W10C8.4b // W10C8.4 /// microcosm // Y102A5C.9 // Y102A5C.9 /// microcosm // Y105C5A.23 // Y105C5A.23 /// microcosm // Y105C5B.9 // Y105C5B.9 /// microcosm // Y105E8A.21.2 // Y105E8A.21 /// microcosm // Y106G6H.5.1 // Y106G6H.5 /// microcosm // Y110A7A.21 // Y110A7A.21 /// microcosm // Y113G7A.12 // Y113G7A.12 /// microcosm // Y116F11B.3.1 // pcp-4 /// microcosm // Y14H12A.1 // Y14H12A.1 /// microcosm // Y17G9A.7b // str-174 /// microcosm // Y19D10A.16 // Y19D10A.16 /// microcosm // Y24D9A.8a.2 // Y24D9A.8 /// microcosm // Y37D8A.19.3 // Y37D8A.19 /// microcosm // Y38F1A.5.3 // cyd-1 /// microcosm // Y38H6C.12 // srh-166 /// microcosm // Y39A1A.5 // rabx-5 /// microcosm // Y39A3B.3 // Y39A3B.3 /// microcosm // Y39B6A.19 // twk-46 /// microcosm // Y39B6A.38 // reps-1 /// microcosm // Y41G9A.4b // Y41G9A.4 /// microcosm // Y43B11AR.4.1 // rps-4 /// microcosm // Y43F8B.3 // Y43F8B.3 /// microcosm // Y43F8C.10 // dmd-3 /// microcosm // Y47G6A.20b // rnp-6 /// microcosm // Y47G7B.1 // srh-128 /// microcosm // Y48G8AL.10 // Y48G8AL.10 /// microcosm // Y48G8AR.3 // Y48G8AR.3 /// microcosm // Y51H4A.6 // Y51H4A.6 /// microcosm // Y52B11B.1 // Y52B11B.1 /// microcosm // Y52D5A.1 // Y52D5A.1 /// microcosm // Y53C10A.2 // Y53C10A.2 /// microcosm // Y53C12B.5b // mab-3 /// microcosm // Y54E10A.11 // Y54E10A.11 /// microcosm // Y54G11A.3.1 // Y54G11A.3 /// microcosm // Y54G11A.3.2 // Y54G11A.3 /// microcosm // Y54G9A.4 // Y54G9A.4 /// microcosm // Y55D9A.2b // Y55D9A.2 /// microcosm // Y55F3AM.10 // Y55F3AM.10 /// microcosm // Y55F3C.3 // Y55F3C.3 /// microcosm // Y57G11C.17 // hhat-2 /// microcosm // Y59E1B.1 // Y59E1B.1 /// microcosm // Y60A3A.21 // Y60A3A.21 /// microcosm // Y64G10A.6 // Y64G10A.6 /// microcosm // Y66C5A.2 // Y66C5A.2 /// microcosm // Y67A10A.8 // Y67A10A.8 /// microcosm // Y67D8C.10a // mca-3 /// microcosm // Y68A4A.10b // Y68A4A.10 /// microcosm // Y6E2A.9b // Y6E2A.9 /// microcosm // Y71F9AL.2 // Y71F9AL.2 /// microcosm // Y71F9B.8 // Y71F9B.8 /// microcosm // Y71H2AM.20a.1 // Y71H2AM.20 /// microcosm // Y73E7A.1a // Y73E7A.1 /// microcosm // Y73E7A.1b // Y73E7A.1 /// microcosm // Y73F8A.33 // Y73F8A.33 /// microcosm // Y75B7AL.2 // Y75B7AL.2 /// microcosm // Y76A2A.1 // tag-164 /// microcosm // Y76A2B.5 // Y76A2B.5 /// microcosm // Y80D3A.9 // Y80D3A.9 /// microcosm // Y81G3A.1 // Y81G3A.1 /// microcosm // Y82E9BL.4 // fbxa-25 /// microcosm // Y82E9BR.20 // Y82E9BR.20 /// microcosm // Y87G2A.11 // Y87G2A.11 /// microcosm // Y87G2A.6.1 // cyn-15 /// microcosm // Y87G2A.6.2 // cyn-15 /// microcosm // Y94H6A.7 // Y94H6A.7 /// microcosm // Y95B8A.10 // pde-6 /// microcosm // ZC15.1 // ZC15.1 /// microcosm // ZC15.3 // ZC15.3 /// microcosm // ZC168.2 // ZC168.2 /// microcosm // ZC239.8 // sri-51 /// microcosm // ZC317.5 // srg-68 /// microcosm // ZC404.8.1 // spn-4 /// microcosm // ZC455.7 // sre-20 /// microcosm // ZC477.3a // ZC477.3 /// microcosm // ZK1086.2 // ZK1086.2 /// microcosm // ZK1307.9 // ZK1307.9 /// microcosm // ZK1321.2c // ZK1321.2 /// microcosm // ZK1321.2f.2 // ZK1321.2 /// microcosm // ZK262.9 // ZK262.9 /// microcosm // ZK270.1 // ptr-23 /// microcosm // ZK370.5.1 // ZK370.5 /// microcosm // ZK381.5a // ZK381.5 /// microcosm // ZK381.5b // ZK381.5 /// microcosm // ZK430.5 // ZK430.5 /// microcosm // ZK455.7 // pgp-3 /// microcosm // ZK54.2a // tps-1 /// microcosm // ZK54.2b.1 // tps-1 /// microcosm // ZK54.2b.2 // tps-1 /// microcosm // ZK54.2b.3 // tps-1 /// microcosm // ZK622.1 // ZK622.1 /// microcosm // ZK637.8a // unc-32 /// microcosm // ZK637.8c // unc-32 /// microcosm // ZK652.10 // tag-307 /// microcosm // ZK688.8.2 // gly-3 /// microcosm // ZK792.2.3 // inx-8 /// microcosm // ZK829.4.3 // ZK829.4 /// microcosm // ZK829.4.4 // ZK829.4 /// microcosm // ZK863.8 // ZK863.8 /// microcosm // ZK867.3 // spp-22 /// microcosm // ZK909.2g // kin-1 /// microcosm // ZK909.6 // ZK909.6 miRNA-4_0 May 13, 2014 miRBase cel-miR-35-3p
MIMAT0020304_st 20500012 MIMAT0020304 cel-miR-36-5p miRNA Caenorhabditis elegans II:11537668-11537690 (+) 23 CGCCAAUUUUCGCUUCAGUGCUA Y62F5A.2 // sense // exon // 1 /// Y62F5A.3 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) --- miRNA-4_0 May 13, 2014 miRBase cel-miR-36-5p
MIMAT0000007_st 20500013 MIMAT0000007 cel-miR-36-3p miRNA Caenorhabditis elegans II:11537709-11537730 (+) 22 UCACCGGGUGAAAAUUCGCAUG Y62F5A.2 // sense // exon // 1 /// Y62F5A.3 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) MTI // --- // W06H8.5 /// microcosm // 6R55.2 // 6R55.2 /// microcosm // AH10.4 // AH10.4 /// microcosm // B0034.2 // B0034.2 /// microcosm // B0035.3 // B0035.3 /// microcosm // B0047.2 // B0047.2 /// microcosm // B0218.6 // clec-51 /// microcosm // B0228.7.2 // B0228.7 /// microcosm // B0284.1 // B0284.1 /// microcosm // B0303.7 // B0303.7 /// microcosm // B0336.1.1 // wrm-1 /// microcosm // B0336.1.2 // wrm-1 /// microcosm // B0403.3 // B0403.3 /// microcosm // B0432.1 // B0432.1 /// microcosm // B0454.6 // B0454.6 /// microcosm // B0496.5 // B0496.5 /// microcosm // B0563.8 // B0563.8 /// microcosm // C01B10.8.2 // C01B10.8 /// microcosm // C01B4.6 // C01B4.6 /// microcosm // C01B9.1 // C01B9.1 /// microcosm // C02B8.2 // C02B8.2 /// microcosm // C02D4.2b // ser-2 /// microcosm // C02D4.2f // ser-2 /// microcosm // C02E7.4 // srh-22 /// microcosm // C02F5.6a // C02F5.6 /// microcosm // C03G6.5 // C03G6.5 /// microcosm // C04C11.2.2 // C04C11.2 /// microcosm // C04F2.4 // srh-229 /// microcosm // C04F5.2 // C04F5.2 /// microcosm // C05D12.3c // C05D12.3 /// microcosm // C05G5.2 // C05G5.2 /// microcosm // C06E1.3 // C06E1.3 /// microcosm // C06G8.4 // srd-7 /// microcosm // C08F8.2a // C08F8.2 /// microcosm // C08F8.2b.1 // C08F8.2 /// microcosm // C08G9.2 // C08G9.2 /// microcosm // C09G1.2 // C09G1.2 /// microcosm // C09G12.3 // srz-78 /// microcosm // C14C6.5 // C14C6.5 /// microcosm // C14F5.5 // sem-5 /// microcosm // C15A11.2 // C15A11.2 /// microcosm // C15A11.4 // C15A11.4 /// microcosm // C15C7.6 // C15C7.6 /// microcosm // C15H9.2 // C15H9.2 /// microcosm // C17H1.5 // C17H1.5 /// microcosm // C18B12.1 // C18B12.1 /// microcosm // C18E9.10 // C18E9.10 /// microcosm // C23F12.2 // flna-2 /// microcosm // C24B9.6 // srt-27 /// microcosm // C24H10.5 // uvt-2 /// microcosm // C25A1.10a // dao-5 /// microcosm // C26B2.3a.1 // nhr-31 /// microcosm // C27A2.2a.3 // rpl-22 /// microcosm // C27C12.1 // C27C12.1 /// microcosm // C27C7.7 // C27C7.7 /// microcosm // C27D6.3 // C27D6.3 /// microcosm // C27H5.5 // col-36 /// microcosm // C29A12.3b // lig-1 /// microcosm // C29F9.5 // C29F9.5 /// microcosm // C29G2.3 // C29G2.3 /// microcosm // C30B5.2a // C30B5.2 /// microcosm // C30B5.2b // C30B5.2 /// microcosm // C30F12.2.1 // C30F12.2 /// microcosm // C30F12.2.2 // C30F12.2 /// microcosm // C30F12.5 // C30F12.5 /// microcosm // C32E12.1 // C32E12.1 /// microcosm // C32E8.6b // C32E8.6 /// microcosm // C32F10.1a.1 // obr-4 /// microcosm // C32F10.1a.2 // obr-4 /// microcosm // C33D12.1 // ceh-31 /// microcosm // C34B2.4 // C34B2.4 /// microcosm // C34B7.3 // cyp-36A1 /// microcosm // C34D4.4a // C34D4.4 /// microcosm // C34F11.3b // C34F11.3 /// microcosm // C34F11.9a // dsh-1 /// microcosm // C34F11.9b // dsh-1 /// microcosm // C34F6.11 // C34F6.11 /// microcosm // C34G6.1 // C34G6.1 /// microcosm // C35B1.1.1 // ubc-1 /// microcosm // C36A4.2 // cyp-25A2 /// microcosm // C37H5.13c // C37H5.13 /// microcosm // C38C3.4a // C38C3.4 /// microcosm // C39D10.11 // C39D10.11 /// microcosm // C41A3.1 // C41A3.1 /// microcosm // C41D11.2 // eif-3.H /// microcosm // C41D11.8.1 // cps-6 /// microcosm // C41D11.8.2 // cps-6 /// microcosm // C44C1.5b.2 // C44C1.5 /// microcosm // C44H9.6.1 // C44H9.6 /// microcosm // C44H9.6.2 // C44H9.6 /// microcosm // C45G9.2 // C45G9.2 /// microcosm // C48D1.3 // cho-1 /// microcosm // C50B8.5 // C50B8.5 /// microcosm // C50C10.8 // sru-33 /// microcosm // C50F4.1.1 // C50F4.1 /// microcosm // C50H2.12 // C50H2.12 /// microcosm // C51E3.7a.1 // egl-3 /// microcosm // C51E3.7b.2 // egl-3 /// microcosm // C54F6.12 // C54F6.12 /// microcosm // C55A6.11 // C55A6.11 /// microcosm // C55B7.4b.1 // acdh-1 /// microcosm // C55B7.4b.2 // acdh-1 /// microcosm // C55B7.4b.5 // acdh-1 /// microcosm // C56A3.7 // cav-2 /// microcosm // CD4.8 // CD4.8 /// microcosm // D1046.5 // D1046.5 /// microcosm // D1081.3 // D1081.3 /// microcosm // D2024.10 // D2024.10 /// microcosm // D2024.2 // D2024.2 /// microcosm // D2096.8 // D2096.8 /// microcosm // DH11.4 // DH11.4 /// microcosm // E02A10.3 // E02A10.3 /// microcosm // E02C12.3 // srx-47 /// microcosm // E02H1.5.2 // E02H1.5 /// microcosm // E03H12.4 // E03H12.4 /// microcosm // F01F1.13 // F01F1.13 /// microcosm // F07C6.4b.1 // F07C6.4 /// microcosm // F07C6.4b.2 // F07C6.4 /// microcosm // F07C6.4c.2 // F07C6.4 /// microcosm // F07F6.1 // F07F6.1 /// microcosm // F08F8.9c.2 // F08F8.9 /// microcosm // F09C6.1 // F09C6.1 /// microcosm // F10G7.12 // F10G7.12 /// microcosm // F10G7.2.2 // tsn-1 /// microcosm // F10G7.9a // F10G7.9 /// microcosm // F10G7.9b.1 // F10G7.9 /// microcosm // F12A10.5 // F12A10.5 /// microcosm // F12A10.6 // F12A10.6 /// microcosm // F12D9.2 // F12D9.2 /// microcosm // F12F6.10 // --- /// microcosm // F13A7.13 // sre-36 /// microcosm // F13D12.8 // F13D12.8 /// microcosm // F13G3.3 // F13G3.3 /// microcosm // F14F8.9 // F14F8.9 /// microcosm // F15D3.2 // F15D3.2 /// microcosm // F15H9.4 // sri-16 /// microcosm // F16B4.9 // nhr-178 /// microcosm // F16H6.5 // F16H6.5 /// microcosm // F17C11.9b.1 // F17C11.9 /// microcosm // F17C11.9c.2 // F17C11.9 /// microcosm // F19D8.2 // F19D8.2 /// microcosm // F19G12.2 // F19G12.2 /// microcosm // F20B6.3 // mrp-6 /// microcosm // F20B6.6 // F20B6.6 /// microcosm // F20D6.5 // F20D6.5 /// microcosm // F21H12.3 // F21H12.3 /// microcosm // F22D6.2.2 // F22D6.2 /// microcosm // F23B12.9 // egl-1 /// microcosm // F23C8.13.1 // F23C8.13 /// microcosm // F23C8.13.2 // F23C8.13 /// microcosm // F23F12.10 // srb-11 /// microcosm // F23H11.3.1 // F23H11.3 /// microcosm // F23H12.1 // snb-2 /// microcosm // F25B3.1 // F25B3.1 /// microcosm // F25C8.2 // amx-3 /// microcosm // F25E5.9 // F25E5.9 /// microcosm // F25H2.5.4 // F25H2.5 /// microcosm // F25H2.5.5 // F25H2.5 /// microcosm // F25H2.5.6 // F25H2.5 /// microcosm // F25H9.3 // F25H9.3 /// microcosm // F26F4.7 // nhl-2 /// microcosm // F26G1.6 // F26G1.6 /// microcosm // F27D9.4 // F27D9.4 /// microcosm // F27E5.3 // F27E5.3 /// microcosm // F27E5.5 // F27E5.5 /// microcosm // F28G4.5 // F28G4.5 /// microcosm // F29A7.8 // F29A7.8 /// microcosm // F29B9.8.1 // F29B9.8 /// microcosm // F29B9.8.2 // F29B9.8 /// microcosm // F29G6.3b.2 // F29G6.3 /// microcosm // F31A9.4 // F31A9.4 /// microcosm // F31D4.3.1 // fkb-6 /// microcosm // F31D4.3.2 // fkb-6 /// microcosm // F31D5.2 // F31D5.2 /// microcosm // F31F4.4 // srx-21 /// microcosm // F32D8.1 // F32D8.1 /// microcosm // F32E10.8 // F32E10.8 /// microcosm // F33A8.5.1 // sdhd-1 /// microcosm // F35D11.3.1 // F35D11.3 /// microcosm // F35D11.3.2 // F35D11.3 /// microcosm // F35E12.4 // F35E12.4 /// microcosm // F35F10.7 // F35F10.7 /// microcosm // F35H10.4.1 // vha-5 /// microcosm // F35H10.4.2 // vha-5 /// microcosm // F36A4.2 // F36A4.2 /// microcosm // F36D4.4 // F36D4.4 /// microcosm // F36F12.7 // F36F12.7 /// microcosm // F36G9.5 // sru-22 /// microcosm // F36G9.6 // sru-23 /// microcosm // F36H5.9 // F36H5.9 /// microcosm // F38A5.11 // F38A5.11 /// microcosm // F38H12.3 // nhr-181 /// microcosm // F38H12.5 // F38H12.5 /// microcosm // F39E9.7 // F39E9.7 /// microcosm // F39F10.2 // F39F10.2 /// microcosm // F39H11.5.1 // pbs-7 /// microcosm // F40A3.6 // F40A3.6 /// microcosm // F40G9.14 // F40G9.14 /// microcosm // F41D3.10 // F41D3.10 /// microcosm // F41D3.5 // F41D3.5 /// microcosm // F41D3.6 // F41D3.6 /// microcosm // F41D9.3b.1 // wrk-1 /// microcosm // F41D9.3b.2 // wrk-1 /// microcosm // F41D9.3c // wrk-1 /// microcosm // F42G9.9d.1 // ptl-1 /// microcosm // F42G9.9d.2 // ptl-1 /// microcosm // F43C11.7 // F43C11.7 /// microcosm // F44A6.4 // F44A6.4 /// microcosm // F44C8.5b // nhr-128 /// microcosm // F45E12.5a // F45E12.5 /// microcosm // F45G2.1 // nas-1 /// microcosm // F45H7.2b // gei-1 /// microcosm // F46A8.5 // F46A8.5 /// microcosm // F46A8.8 // F46A8.8 /// microcosm // F46F2.1 // F46F2.1 /// microcosm // F46F5.15 // F46F5.15 /// microcosm // F46F5.4 // F46F5.4 /// microcosm // F46F6.4a // dyf-6 /// microcosm // F47B10.6 // F47B10.6 /// microcosm // F47D2.1 // srt-19 /// microcosm // F47G4.3 // gpdh-1 /// microcosm // F47G6.2 // F47G6.2 /// microcosm // F47G9.3 // F47G9.3 /// microcosm // F48G7.12 // F48G7.12 /// microcosm // F49E11.2 // F49E11.2 /// microcosm // F49E12.6 // F49E12.6 /// microcosm // F49F1.7 // F49F1.7 /// microcosm // F52F12.6 // ekl-2 /// microcosm // F53A9.10b.3 // tnt-2 /// microcosm // F53A9.10b.4 // tnt-2 /// microcosm // F53B1.9 // F53B1.9 /// microcosm // F53F10.8 // F53F10.8 /// microcosm // F53G2.4b // pqn-42 /// microcosm // F54B8.10 // srbc-52 /// microcosm // F54C8.1 // F54C8.1 /// microcosm // F54E7.5 // sdz-21 /// microcosm // F54F3.4 // F54F3.4 /// microcosm // F54G8.5 // ptr-9 /// microcosm // F54H12.4 // F54H12.4 /// microcosm // F55A12.10 // F55A12.10 /// microcosm // F55A4.8a // F55A4.8 /// microcosm // F56F11.3.1 // klf-1 /// microcosm // F56F3.5.2 // rps-1 /// microcosm // F57B7.2 // F57B7.2 /// microcosm // F57C7.2a // nhx-5 /// microcosm // F58B4.3 // F58B4.3 /// microcosm // F58E10.1a // F58E10.1 /// microcosm // F58G11.4 // F58G11.4 /// microcosm // F58G6.2 // srm-3 /// microcosm // F59A7.3 // srab-13 /// microcosm // F59D6.3 // F59D6.3 /// microcosm // F59E12.5a.2 // npl-4.2 /// microcosm // H04J21.3a.2 // gip-1 /// microcosm // H05C05.1a // H05C05.1 /// microcosm // H06A10.1 // H06A10.1 /// microcosm // H09F14.1 // H09F14.1 /// microcosm // H10E21.5 // H10E21.5 /// microcosm // H12D21.5 // H12D21.5 /// microcosm // H19M22.2a // let-805 /// microcosm // H19M22.2c // let-805 /// microcosm // H20J04.9 // H20J04.9 /// microcosm // H21P03.1 // mbf-1 /// microcosm // H28G03.6 // mtm-5 /// microcosm // K02B12.7 // K02B12.7 /// microcosm // K02E10.8 // syg-1 /// microcosm // K02E11.5 // K02E11.5 /// microcosm // K02E7.9 // K02E7.9 /// microcosm // K02F2.6 // ser-3 /// microcosm // K03B8.1 // nas-16 /// microcosm // K03B8.11 // K03B8.11 /// microcosm // K03C7.3 // K03C7.3 /// microcosm // K03E6.1 // lim-6 /// microcosm // K03H1.8 // K03H1.8 /// microcosm // K04C1.3.1 // K04C1.3 /// microcosm // K04C1.3.2 // K04C1.3 /// microcosm // K04F10.4f // bli-4 /// microcosm // K05F1.6a // K05F1.6 /// microcosm // K05F1.6b // K05F1.6 /// microcosm // K07E12.1a // dig-1 /// microcosm // K07H8.10.1 // K07H8.10 /// microcosm // K07H8.10.2 // K07H8.10 /// microcosm // K07H8.8 // K07H8.8 /// microcosm // K07H8.9 // K07H8.9 /// microcosm // K08A2.5c.2 // nhr-88 /// microcosm // K08B4.5 // K08B4.5 /// microcosm // K08D10.2 // dnj-15 /// microcosm // K08E3.6.2 // cyk-4 /// microcosm // K08E5.2b.3 // nac-3 /// microcosm // K08F4.3 // K08F4.3 /// microcosm // K08F9.2.3 // tag-216 /// microcosm // K09F6.10 // K09F6.10 /// microcosm // K10B2.1.2 // lin-23 /// microcosm // K10C2.6 // K10C2.6 /// microcosm // K11E4.5b // nhr-71 /// microcosm // K11G9.4 // egl-46 /// microcosm // K12D9.9 // srw-112 /// microcosm // K12H4.7b.2 // K12H4.7 /// microcosm // M01D1.9 // fbxb-40 /// microcosm // M03F8.1 // M03F8.1 /// microcosm // M05B5.2 // M05B5.2 /// microcosm // M05D6.9 // M05D6.9 /// microcosm // PAR2.3a // aak-1 /// microcosm // PAR2.3b.2 // aak-1 /// microcosm // R03G8.1 // R03G8.1 /// microcosm // R05F9.6 // R05F9.6 /// microcosm // R05H11.2 // R05H11.2 /// microcosm // R06C7.6 // R06C7.6 /// microcosm // R08A2.1 // R08A2.1 /// microcosm // R08C7.12.1 // R08C7.12 /// microcosm // R08C7.12.2 // R08C7.12 /// microcosm // R107.4b // R107.4 /// microcosm // R107.4c // R107.4 /// microcosm // R10E4.2a.1 // tag-310 /// microcosm // R10E9.1.1 // msi-1 /// microcosm // R10E9.1.2 // msi-1 /// microcosm // R10F2.4 // R10F2.4 /// microcosm // R11D1.11 // dhs-21 /// microcosm // R12E2.2.2 // R12E2.2 /// microcosm // R12E2.3.2 // rpn-8 /// microcosm // R13F6.4a // ten-1 /// microcosm // R13H8.1e.1 // daf-16 /// microcosm // R148.3a // R148.3 /// microcosm // R151.5b // dpy-31 /// microcosm // R74.3b.1 // xbp-1 /// microcosm // R74.3b.2 // xbp-1 /// microcosm // T02B11.3a // T02B11.3 /// microcosm // T03D8.4 // grl-14 /// microcosm // T03F6.5 // lis-1 /// microcosm // T04A8.7a // T04A8.7 /// microcosm // T04A8.7b // T04A8.7 /// microcosm // T04B8.1 // T04B8.1 /// microcosm // T04C12.7 // T04C12.7 /// microcosm // T04F3.2 // T04F3.2 /// microcosm // T04G9.6 // T04G9.6 /// microcosm // T04H1.7 // ugt-55 /// microcosm // T05C1.4a // T05C1.4 /// microcosm // T05C1.4b // T05C1.4 /// microcosm // T05C1.4c // T05C1.4 /// microcosm // T05F1.5 // T05F1.5 /// microcosm // T05H4.6.3 // T05H4.6a /// microcosm // T06E4.5 // T06E4.5 /// microcosm // T06G6.7 // srw-88 /// microcosm // T07F8.3b.1 // gld-3 /// microcosm // T07G12.4 // T07G12.4 /// microcosm // T07G12.8 // T07G12.8 /// microcosm // T10B10.3.2 // T10B10.3 /// microcosm // T12F5.4 // lin-59 /// microcosm // T14B1.2 // T14B1.2 /// microcosm // T14E8.2 // T14E8.2 /// microcosm // T15B7.13 // T15B7.13 /// microcosm // T17H7.4g.1 // gei-16 /// microcosm // T17H7.4k.2 // gei-16 /// microcosm // T18D3.6 // T18D3.6 /// microcosm // T19C3.8 // fem-2 /// microcosm // T20B12.1 // T20B12.1 /// microcosm // T20F7.5 // T20F7.5 /// microcosm // T21G5.6 // --- /// microcosm // T22C1.3 // T22C1.3 /// microcosm // T22F3.6 // srh-212 /// microcosm // T23B12.11 // T23B12.11 /// microcosm // T23G5.1.2 // rnr-1 /// microcosm // T23G5.1.3 // rnr-1 /// microcosm // T23G5.2b.2 // T23G5.2 /// microcosm // T24A11.3 // toh-1 /// microcosm // T25B6.5 // T25B6.5 /// microcosm // T25B9.6 // T25B9.6 /// microcosm // T26A5.6.1 // T26A5.6 /// microcosm // T26A5.6.2 // T26A5.6 /// microcosm // T26A8.1.1 // T26A8.1 /// microcosm // T26A8.1.2 // T26A8.1 /// microcosm // T26A8.1.3 // T26A8.1 /// microcosm // T26H8.2 // srx-48 /// microcosm // T26H8.3 // srx-49 /// microcosm // T28D6.5a // T28D6.5 /// microcosm // T28D6.5b // T28D6.5 /// microcosm // T28F2.2 // T28F2.2 /// microcosm // W01A8.8 // W01A8.8 /// microcosm // W01C9.4 // W01C9.4 /// microcosm // W01H2.3b // rab-37 /// microcosm // W02D7.9 // W02D7.9 /// microcosm // W03F8.10 // W03F8.10 /// microcosm // W03G11.2 // W03G11.2 /// microcosm // W03G9.1.2 // snf-1 /// microcosm // W08F4.3.1 // W08F4.3 /// microcosm // W08F4.3.2 // W08F4.3 /// microcosm // W09D6.4 // W09D6.4 /// microcosm // W10C8.4b // W10C8.4 /// microcosm // Y102A5C.9 // Y102A5C.9 /// microcosm // Y105C5A.23 // Y105C5A.23 /// microcosm // Y105C5B.9 // Y105C5B.9 /// microcosm // Y108F1.3 // Y108F1.3 /// microcosm // Y110A2AL.4a // Y110A2AL.4 /// microcosm // Y110A2AL.4b // Y110A2AL.4 /// microcosm // Y110A7A.21 // Y110A7A.21 /// microcosm // Y116A8C.29 // Y116A8C.29 /// microcosm // Y116F11B.3.1 // pcp-4 /// microcosm // Y14H12A.1 // Y14H12A.1 /// microcosm // Y19D10A.16 // Y19D10A.16 /// microcosm // Y24D9A.8a.2 // Y24D9A.8 /// microcosm // Y25C1A.3 // Y25C1A.3 /// microcosm // Y38H6C.12 // srh-166 /// microcosm // Y39A1A.5 // rabx-5 /// microcosm // Y39B6A.14 // pro-3 /// microcosm // Y39B6A.19 // twk-46 /// microcosm // Y39B6A.38 // reps-1 /// microcosm // Y39G10AR.20.2 // Y39G10AR.20 /// microcosm // Y43B11AR.4.1 // rps-4 /// microcosm // Y43F8B.3 // Y43F8B.3 /// microcosm // Y43F8C.10 // dmd-3 /// microcosm // Y46E12A.4 // Y46E12A.4 /// microcosm // Y47G6A.20b // rnp-6 /// microcosm // Y47G7B.1 // srh-128 /// microcosm // Y48C3A.8 // Y48C3A.8 /// microcosm // Y48G8AR.3 // Y48G8AR.3 /// microcosm // Y4C6A.2a // mgl-3 /// microcosm // Y51H4A.6 // Y51H4A.6 /// microcosm // Y51H7C.8 // Y51H7C.8 /// microcosm // Y52B11B.1 // Y52B11B.1 /// microcosm // Y52D5A.1 // Y52D5A.1 /// microcosm // Y53C10A.2 // Y53C10A.2 /// microcosm // Y53C12A.2.1 // glt-5 /// microcosm // Y53C12B.5b // mab-3 /// microcosm // Y53H1A.2 // Y53H1A.2 /// microcosm // Y54E10A.11 // Y54E10A.11 /// microcosm // Y54F10AM.2a // feh-1 /// microcosm // Y54F10AM.2b // feh-1 /// microcosm // Y54G11A.3.1 // Y54G11A.3 /// microcosm // Y54G9A.4 // Y54G9A.4 /// microcosm // Y55F3AM.10 // Y55F3AM.10 /// microcosm // Y56A3A.18.1 // Y56A3A.18 /// microcosm // Y57G11C.11b.1 // coq-3 /// microcosm // Y57G11C.11b.2 // coq-3 /// microcosm // Y57G11C.11b.3 // coq-3 /// microcosm // Y57G11C.17 // hhat-2 /// microcosm // Y60A3A.21 // Y60A3A.21 /// microcosm // Y62E10A.20.1 // Y62E10A.20 /// microcosm // Y64G10A.6 // Y64G10A.6 /// microcosm // Y67A10A.7 // Y67A10A.7 /// microcosm // Y67A10A.8 // Y67A10A.8 /// microcosm // Y67A6A.1 // Y67A6A.1 /// microcosm // Y67D8C.10a // mca-3 /// microcosm // Y67D8C.10c // mca-3 /// microcosm // Y6E2A.9b // Y6E2A.9 /// microcosm // Y71F9AL.2 // Y71F9AL.2 /// microcosm // Y71F9B.8 // Y71F9B.8 /// microcosm // Y71H2AM.20a.1 // Y71H2AM.20 /// microcosm // Y71H2B.2 // Y71H2B.2 /// microcosm // Y73F8A.33 // Y73F8A.33 /// microcosm // Y75B7AL.2 // Y75B7AL.2 /// microcosm // Y76A2A.1 // tag-164 /// microcosm // Y76A2B.5 // Y76A2B.5 /// microcosm // Y81G3A.1 // Y81G3A.1 /// microcosm // Y82E9BL.4 // fbxa-25 /// microcosm // Y82E9BR.20 // Y82E9BR.20 /// microcosm // Y94H6A.7 // Y94H6A.7 /// microcosm // Y95B8A.10 // pde-6 /// microcosm // ZC15.1 // ZC15.1 /// microcosm // ZC155.7 // syn-16 /// microcosm // ZC168.2 // ZC168.2 /// microcosm // ZC196.8 // ZC196.8 /// microcosm // ZC239.8 // sri-51 /// microcosm // ZC317.5 // srg-68 /// microcosm // ZC455.7 // sre-20 /// microcosm // ZK1037.3 // srt-22 /// microcosm // ZK1086.2 // ZK1086.2 /// microcosm // ZK1307.9 // ZK1307.9 /// microcosm // ZK1321.2c // ZK1321.2 /// microcosm // ZK1321.2f.2 // ZK1321.2 /// microcosm // ZK270.1 // ptr-23 /// microcosm // ZK430.5 // ZK430.5 /// microcosm // ZK455.7 // pgp-3 /// microcosm // ZK512.5.2 // ZK512.5 /// microcosm // ZK54.2a // tps-1 /// microcosm // ZK54.2b.1 // tps-1 /// microcosm // ZK54.2b.2 // tps-1 /// microcosm // ZK54.2b.3 // tps-1 /// microcosm // ZK622.1 // ZK622.1 /// microcosm // ZK637.8a // unc-32 /// microcosm // ZK688.8.1 // gly-3 /// microcosm // ZK688.8.2 // gly-3 /// microcosm // ZK792.2.3 // inx-8 /// microcosm // ZK867.3 // spp-22 /// microcosm // ZK896.4 // ZK896.4 /// microcosm // ZK909.2g // kin-1 /// microcosm // ZK909.6 // ZK909.6 miRNA-4_0 May 13, 2014 miRBase cel-miR-36-3p
MIMAT0015094_st 20500014 MIMAT0015094 cel-miR-37-5p miRNA Caenorhabditis elegans II:11537790-11537810 (+) 21 UGUGGGUGUCCGUUGCGGUGC Y62F5A.14 // sense // exon // 1 /// Y62F5A.3 // sense // exon // 1 /// Y62F5A.4 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) --- miRNA-4_0 May 13, 2014 miRBase cel-miR-37-5p
MIMAT0000008_st 20500015 MIMAT0000008 cel-miR-37-3p miRNA Caenorhabditis elegans II:11537829-11537850 (+) 22 UCACCGGGUGAACACUUGCAGU Y62F5A.14 // sense // exon // 1 /// Y62F5A.3 // sense // exon // 1 /// Y62F5A.4 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) MTI // --- // W06H8.5 /// microcosm // 6R55.2 // 6R55.2 /// microcosm // AH10.4 // AH10.4 /// microcosm // B0034.2 // B0034.2 /// microcosm // B0035.3 // B0035.3 /// microcosm // B0047.1a // bath-20 /// microcosm // B0047.2 // B0047.2 /// microcosm // B0228.7.2 // B0228.7 /// microcosm // B0280.11 // B0280.11 /// microcosm // B0284.1 // B0284.1 /// microcosm // B0336.1.1 // wrm-1 /// microcosm // B0336.1.2 // wrm-1 /// microcosm // B0399.1b // B0399.1 /// microcosm // B0399.1c // B0399.1 /// microcosm // B0432.1 // B0432.1 /// microcosm // B0496.5 // B0496.5 /// microcosm // B0524.2 // B0524.2 /// microcosm // C01B10.8.1 // C01B10.8 /// microcosm // C01B10.8.2 // C01B10.8 /// microcosm // C01B4.6 // C01B4.6 /// microcosm // C01G5.7 // C01G5.7 /// microcosm // C02B8.2 // C02B8.2 /// microcosm // C03C10.4 // C03C10.4 /// microcosm // C03G6.5 // C03G6.5 /// microcosm // C04C11.2.1 // C04C11.2 /// microcosm // C04C11.2.2 // C04C11.2 /// microcosm // C04F5.2 // C04F5.2 /// microcosm // C04F6.4b.1 // unc-78 /// microcosm // C04F6.4b.2 // unc-78 /// microcosm // C05E4.11 // srj-24 /// microcosm // C06E1.3 // C06E1.3 /// microcosm // C06G8.4 // srd-7 /// microcosm // C08F8.2a // C08F8.2 /// microcosm // C08F8.2b.1 // C08F8.2 /// microcosm // C08G9.2 // C08G9.2 /// microcosm // C09C7.1 // zig-4 /// microcosm // C09G1.2 // C09G1.2 /// microcosm // C09G12.3 // srz-78 /// microcosm // C15A11.2 // C15A11.2 /// microcosm // C15A11.4 // C15A11.4 /// microcosm // C15C7.6 // C15C7.6 /// microcosm // C15H9.2 // C15H9.2 /// microcosm // C16C8.8 // C16C8.8 /// microcosm // C17E7.2 // srh-190 /// microcosm // C17H1.5 // C17H1.5 /// microcosm // C17H1.8 // C17H1.8 /// microcosm // C18G1.9 // C18G1.9 /// microcosm // C23F12.2 // flna-2 /// microcosm // C23G10.3.2 // rps-3 /// microcosm // C23H5.8b.1 // C23H5.8 /// microcosm // C24B5.2b.1 // spas-1 /// microcosm // C24B5.2b.2 // spas-1 /// microcosm // C24B9.6 // srt-27 /// microcosm // C24H10.5 // uvt-2 /// microcosm // C27A2.2a.3 // rpl-22 /// microcosm // C27C7.7 // C27C7.7 /// microcosm // C27D6.3 // C27D6.3 /// microcosm // C27H5.5 // col-36 /// microcosm // C27H5.7b.1 // dyf-13 /// microcosm // C29E6.3 // pph-2 /// microcosm // C29F5.8 // C29F5.8 /// microcosm // C29F9.5 // C29F9.5 /// microcosm // C29G2.3 // C29G2.3 /// microcosm // C30B5.2a // C30B5.2 /// microcosm // C30B5.2b // C30B5.2 /// microcosm // C30F12.2.1 // C30F12.2 /// microcosm // C30F12.2.2 // C30F12.2 /// microcosm // C30F12.5 // C30F12.5 /// microcosm // C32E12.1 // C32E12.1 /// microcosm // C32F10.1a.1 // obr-4 /// microcosm // C32F10.1a.2 // obr-4 /// microcosm // C33D12.1 // ceh-31 /// microcosm // C34B2.4 // C34B2.4 /// microcosm // C34C12.1 // C34C12.1 /// microcosm // C34F11.3b // C34F11.3 /// microcosm // C34F11.9a // dsh-1 /// microcosm // C34F11.9b // dsh-1 /// microcosm // C34F6.11 // C34F6.11 /// microcosm // C34G6.1 // C34G6.1 /// microcosm // C35B1.1.1 // ubc-1 /// microcosm // C36A4.2 // cyp-25A2 /// microcosm // C36E8.2 // C36E8.2 /// microcosm // C38C3.4a // C38C3.4 /// microcosm // C39D10.11 // C39D10.11 /// microcosm // C41A3.1 // C41A3.1 /// microcosm // C41D11.2 // eif-3.H /// microcosm // C41D11.8.1 // cps-6 /// microcosm // C41D11.8.2 // cps-6 /// microcosm // C41G11.4a // C41G11.4 /// microcosm // C41G11.4b // C41G11.4 /// microcosm // C41G11.4c // C41G11.4 /// microcosm // C43F9.4 // C43F9.4 /// microcosm // C44C10.8 // hnd-1 /// microcosm // C45G9.2 // C45G9.2 /// microcosm // C48D1.3 // cho-1 /// microcosm // C48E7.8 // C48E7.8 /// microcosm // C49H3.10 // imb-6 /// microcosm // C50B8.5 // C50B8.5 /// microcosm // C50F4.1.1 // C50F4.1 /// microcosm // C50H2.12 // C50H2.12 /// microcosm // C51E3.7a.1 // egl-3 /// microcosm // C51E3.7b.2 // egl-3 /// microcosm // C54F6.12 // C54F6.12 /// microcosm // C55A6.11 // C55A6.11 /// microcosm // C55F2.1c // C55F2.1 /// microcosm // C56A3.7 // cav-2 /// microcosm // C56C10.8.1 // icd-1 /// microcosm // C56G2.9 // C56G2.9 /// microcosm // CD4.8 // CD4.8 /// microcosm // D1053.2 // D1053.2 /// microcosm // D1065.4a // srh-210 /// microcosm // D1081.3 // D1081.3 /// microcosm // D2024.10 // D2024.10 /// microcosm // D2024.2 // D2024.2 /// microcosm // D2096.8 // D2096.8 /// microcosm // DH11.4 // DH11.4 /// microcosm // E02A10.3 // E02A10.3 /// microcosm // E02C12.3 // srx-47 /// microcosm // E04F6.11a // clh-3 /// microcosm // EEED8.7b // rsp-4 /// microcosm // F01F1.13 // F01F1.13 /// microcosm // F07A11.1 // F07A11.1 /// microcosm // F07C6.4b.1 // F07C6.4 /// microcosm // F07C6.4b.2 // F07C6.4 /// microcosm // F07C6.4c.2 // F07C6.4 /// microcosm // F07F6.1 // F07F6.1 /// microcosm // F08D12.6 // fbxb-108 /// microcosm // F10G7.12 // F10G7.12 /// microcosm // F10G7.2.2 // tsn-1 /// microcosm // F10G7.9a // F10G7.9 /// microcosm // F10G7.9b.1 // F10G7.9 /// microcosm // F11A6.2 // plsc-4 /// microcosm // F12A10.6 // F12A10.6 /// microcosm // F12D9.2 // F12D9.2 /// microcosm // F12F6.10 // --- /// microcosm // F13A2.8 // nhr-118 /// microcosm // F13A7.13 // sre-36 /// microcosm // F13B10.2a.1 // rpl-3 /// microcosm // F13B10.2d.2 // rpl-3 /// microcosm // F13D12.8 // F13D12.8 /// microcosm // F13G3.3 // F13G3.3 /// microcosm // F14F8.9 // F14F8.9 /// microcosm // F15D3.2 // F15D3.2 /// microcosm // F15D3.8 // F15D3.8 /// microcosm // F15H10.9 // F15H10.9 /// microcosm // F15H9.4 // sri-16 /// microcosm // F16B4.9 // nhr-178 /// microcosm // F16H6.4 // F16H6.4 /// microcosm // F16H6.5 // F16H6.5 /// microcosm // F17C11.5 // F17C11.5 /// microcosm // F17C11.9b.1 // F17C11.9 /// microcosm // F17C11.9c.2 // F17C11.9 /// microcosm // F18A12.4 // F18A12.4 /// microcosm // F18C12.2b // rme-8 /// microcosm // F18E2.2 // tag-167 /// microcosm // F19G12.2 // F19G12.2 /// microcosm // F20B6.6 // F20B6.6 /// microcosm // F20D6.5 // F20D6.5 /// microcosm // F22D6.5 // prp-4 /// microcosm // F23B12.9 // egl-1 /// microcosm // F23C8.13.1 // F23C8.13 /// microcosm // F23C8.13.2 // F23C8.13 /// microcosm // F23H12.1 // snb-2 /// microcosm // F25B3.1 // F25B3.1 /// microcosm // F25E5.7 // F25E5.7 /// microcosm // F25H2.5.4 // F25H2.5 /// microcosm // F25H2.5.5 // F25H2.5 /// microcosm // F25H2.5.6 // F25H2.5 /// microcosm // F25H9.3 // F25H9.3 /// microcosm // F26F4.7 // nhl-2 /// microcosm // F27E5.3 // F27E5.3 /// microcosm // F27E5.5 // F27E5.5 /// microcosm // F29B9.8.1 // F29B9.8 /// microcosm // F29B9.8.2 // F29B9.8 /// microcosm // F31A9.4 // F31A9.4 /// microcosm // F31D4.3.1 // fkb-6 /// microcosm // F31D4.3.2 // fkb-6 /// microcosm // F31F4.4 // srx-21 /// microcosm // F32A11.2 // hpr-17 /// microcosm // F32D1.9.2 // F32D1.9 /// microcosm // F32D8.1 // F32D8.1 /// microcosm // F32E10.8 // F32E10.8 /// microcosm // F35D11.3.1 // F35D11.3 /// microcosm // F35D11.3.2 // F35D11.3 /// microcosm // F35D6.1a // fem-1 /// microcosm // F35H10.4.1 // vha-5 /// microcosm // F35H10.4.2 // vha-5 /// microcosm // F36A4.2 // F36A4.2 /// microcosm // F36F12.7 // F36F12.7 /// microcosm // F36F2.8 // F36F2.8 /// microcosm // F38A5.11 // F38A5.11 /// microcosm // F38E9.1 // F38E9.1 /// microcosm // F38H4.6 // F38H4.6 /// microcosm // F39E9.7 // F39E9.7 /// microcosm // F39H11.5.1 // pbs-7 /// microcosm // F40A3.6 // F40A3.6 /// microcosm // F40D4.2 // srh-155 /// microcosm // F40G9.14 // F40G9.14 /// microcosm // F41D3.10 // F41D3.10 /// microcosm // F41D3.5 // F41D3.5 /// microcosm // F41D3.6 // F41D3.6 /// microcosm // F41D3.7 // F41D3.7 /// microcosm // F41D9.3b.1 // wrk-1 /// microcosm // F41D9.3b.2 // wrk-1 /// microcosm // F41D9.3c // wrk-1 /// microcosm // F42C5.2 // F42C5.2 /// microcosm // F42G9.9d.1 // ptl-1 /// microcosm // F42G9.9d.2 // ptl-1 /// microcosm // F44B9.8 // F44B9.8 /// microcosm // F44C8.5b // nhr-128 /// microcosm // F45E12.5a // F45E12.5 /// microcosm // F45G2.1 // nas-1 /// microcosm // F46A8.5 // F46A8.5 /// microcosm // F46A8.8 // F46A8.8 /// microcosm // F46F5.15 // F46F5.15 /// microcosm // F46F5.4 // F46F5.4 /// microcosm // F47D2.5 // srt-36 /// microcosm // F47G4.3 // gpdh-1 /// microcosm // F47G6.2 // F47G6.2 /// microcosm // F47G9.3 // F47G9.3 /// microcosm // F48B9.3 // F48B9.3 /// microcosm // F48E3.9 // F48E3.9 /// microcosm // F48G7.12 // F48G7.12 /// microcosm // F49E11.2 // F49E11.2 /// microcosm // F49F1.7 // F49F1.7 /// microcosm // F52F12.6 // ekl-2 /// microcosm // F53A9.10b.3 // tnt-2 /// microcosm // F53A9.10b.4 // tnt-2 /// microcosm // F53B1.9 // F53B1.9 /// microcosm // F53G2.4b // pqn-42 /// microcosm // F54C8.1 // F54C8.1 /// microcosm // F54E7.5 // sdz-21 /// microcosm // F54F3.4 // F54F3.4 /// microcosm // F54H12.4 // F54H12.4 /// microcosm // F55A4.8a // F55A4.8 /// microcosm // F56B3.2b // F56B3.2 /// microcosm // F56F11.3.1 // klf-1 /// microcosm // F56F3.5.2 // rps-1 /// microcosm // F57B1.8 // F57B1.8 /// microcosm // F57B7.2 // F57B7.2 /// microcosm // F57C7.2a // nhx-5 /// microcosm // F58A3.5 // F58A3.5 /// microcosm // F58E1.2 // fbxb-25 /// microcosm // F58E10.1a // F58E10.1 /// microcosm // F58E10.1b // F58E10.1 /// microcosm // F58G1.7 // F58G1.7 /// microcosm // F58G6.2 // srm-3 /// microcosm // F59A7.3 // srab-13 /// microcosm // F59B10.4a // F59B10.4 /// microcosm // F59B10.4b // F59B10.4 /// microcosm // F59C6.3 // F59C6.3 /// microcosm // F59E12.5a.2 // npl-4.2 /// microcosm // F59E12.5b // npl-4.2 /// microcosm // H05C05.1a // H05C05.1 /// microcosm // H06A10.1 // H06A10.1 /// microcosm // H06H21.3.1 // H06H21.3 /// microcosm // H06H21.3.2 // H06H21.3 /// microcosm // H06I04.4a.2 // ubl-1 /// microcosm // H09I01.1 // H09I01.1 /// microcosm // H10E21.5 // H10E21.5 /// microcosm // H14N18.4b // H14N18.4 /// microcosm // H19M22.2a // let-805 /// microcosm // H19M22.2c // let-805 /// microcosm // H20J04.9 // H20J04.9 /// microcosm // H21P03.1 // mbf-1 /// microcosm // H24D24.1 // srw-59 /// microcosm // H28G03.6 // mtm-5 /// microcosm // K02B12.7 // K02B12.7 /// microcosm // K02E10.8 // syg-1 /// microcosm // K02E11.5 // K02E11.5 /// microcosm // K02E7.9 // K02E7.9 /// microcosm // K02F2.6 // ser-3 /// microcosm // K03B4.4 // K03B4.4 /// microcosm // K03B8.11 // K03B8.11 /// microcosm // K03D3.1 // srz-74 /// microcosm // K03E6.1 // lim-6 /// microcosm // K04F1.13 // K04F1.13 /// microcosm // K04F10.4f // bli-4 /// microcosm // K04G11.5 // irk-3 /// microcosm // K07E12.1a // dig-1 /// microcosm // K07H8.10.1 // K07H8.10 /// microcosm // K07H8.10.2 // K07H8.10 /// microcosm // K07H8.8 // K07H8.8 /// microcosm // K07H8.9 // K07H8.9 /// microcosm // K08A2.5c.2 // nhr-88 /// microcosm // K08B4.5 // K08B4.5 /// microcosm // K08E5.2b.3 // nac-3 /// microcosm // K08F4.3 // K08F4.3 /// microcosm // K08F9.2.3 // tag-216 /// microcosm // K08H10.2a.2 // K08H10.2 /// microcosm // K08H10.2b // K08H10.2 /// microcosm // K09D9.1 // K09D9.1 /// microcosm // K09F6.10 // K09F6.10 /// microcosm // K10C2.6 // K10C2.6 /// microcosm // K11D2.1 // K11D2.1 /// microcosm // M01D1.9 // fbxb-40 /// microcosm // M03F8.1 // M03F8.1 /// microcosm // M05D6.9 // M05D6.9 /// microcosm // R03G8.1 // R03G8.1 /// microcosm // R05D8.2 // srj-18 /// microcosm // R05H11.2 // R05H11.2 /// microcosm // R08C7.12.1 // R08C7.12 /// microcosm // R08C7.12.2 // R08C7.12 /// microcosm // R08E5.4 // R08E5.4 /// microcosm // R08H2.4 // srh-251 /// microcosm // R107.4a // R107.4 /// microcosm // R107.4b // R107.4 /// microcosm // R107.4c // R107.4 /// microcosm // R10D12.10 // R10D12.10 /// microcosm // R10E4.2a.1 // tag-310 /// microcosm // R10F2.4 // R10F2.4 /// microcosm // R11B5.1 // tag-236 /// microcosm // R11D1.11 // dhs-21 /// microcosm // R11E3.2 // R11E3.2 /// microcosm // R11G10.2 // R11G10.2 /// microcosm // R11G11.3 // R11G11.3 /// microcosm // R12E2.2.2 // R12E2.2 /// microcosm // R13H8.1e.1 // daf-16 /// microcosm // R148.3a // R148.3 /// microcosm // R151.5b // dpy-31 /// microcosm // R17.3 // R17.3 /// microcosm // R186.4 // lin-46 /// microcosm // R31.2a // R31.2 /// microcosm // R31.2c.1 // R31.2 /// microcosm // T01B7.5b // T01B7.5 /// microcosm // T03D3.12 // srj-49 /// microcosm // T03D8.4 // grl-14 /// microcosm // T03F6.5 // lis-1 /// microcosm // T04B8.1 // T04B8.1 /// microcosm // T04C12.7 // T04C12.7 /// microcosm // T04F3.2 // T04F3.2 /// microcosm // T04G9.6 // T04G9.6 /// microcosm // T04H1.7 // ugt-55 /// microcosm // T05B11.7 // T05B11.7 /// microcosm // T05C1.4a // T05C1.4 /// microcosm // T05C1.4b // T05C1.4 /// microcosm // T05C1.4c // T05C1.4 /// microcosm // T05F1.5 // T05F1.5 /// microcosm // T06E4.5 // T06E4.5 /// microcosm // T07C5.2 // nhr-272 /// microcosm // T07F8.3b.1 // gld-3 /// microcosm // T07G12.4 // T07G12.4 /// microcosm // T07G12.8 // T07G12.8 /// microcosm // T09E11.11 // T09E11.11 /// microcosm // T09F3.3.3 // gpd-1 /// microcosm // T09F5.5 // srh-55 /// microcosm // T10B10.3.2 // T10B10.3 /// microcosm // T11F9.4 // aat-6 /// microcosm // T12F5.4 // lin-59 /// microcosm // T14B1.2 // T14B1.2 /// microcosm // T14E8.2 // T14E8.2 /// microcosm // T15B7.13 // T15B7.13 /// microcosm // T15D6.7 // T15D6.7 /// microcosm // T16A1.8 // fbxb-37 /// microcosm // T17H7.4g.1 // gei-16 /// microcosm // T17H7.4k.2 // gei-16 /// microcosm // T18D3.6 // T18D3.6 /// microcosm // T19A5.5 // nhr-219 /// microcosm // T19B10.1 // cyp-29A2 /// microcosm // T20F7.5 // T20F7.5 /// microcosm // T22C1.3 // T22C1.3 /// microcosm // T22D1.5.1 // T22D1.5 /// microcosm // T22D1.5.2 // T22D1.5 /// microcosm // T22H2.5a.2 // plsc-2 /// microcosm // T23B12.11 // T23B12.11 /// microcosm // T23G5.2b.2 // T23G5.2 /// microcosm // T24A11.3 // toh-1 /// microcosm // T24E12.2 // T24E12.2 /// microcosm // T25B6.2 // T25B6.2 /// microcosm // T26A8.1.1 // T26A8.1 /// microcosm // T26A8.1.2 // T26A8.1 /// microcosm // T26A8.1.3 // T26A8.1 /// microcosm // T26E3.10 // T26E3.10 /// microcosm // T26H8.2 // srx-48 /// microcosm // T27D12.2a // clh-1 /// microcosm // T27D12.3 // T27D12.3 /// microcosm // T27E7.1 // T27E7.1 /// microcosm // T27E9.7.1 // T27E9.7 /// microcosm // T27E9.7.2 // T27E9.7 /// microcosm // T27F7.2a // shc-2 /// microcosm // T27F7.2b.2 // shc-2 /// microcosm // T28D6.5a // T28D6.5 /// microcosm // T28D6.5b // T28D6.5 /// microcosm // T28F2.2 // T28F2.2 /// microcosm // W01A8.8 // W01A8.8 /// microcosm // W01C9.4 // W01C9.4 /// microcosm // W01H2.3b // rab-37 /// microcosm // W02D7.9 // W02D7.9 /// microcosm // W03C9.7.1 // mex-1 /// microcosm // W03C9.7.2 // mex-1 /// microcosm // W03F8.10 // W03F8.10 /// microcosm // W03G11.2 // W03G11.2 /// microcosm // W04G5.3 // W04G5.3 /// microcosm // W08E12.8 // W08E12.8 /// microcosm // W08F4.3.1 // W08F4.3 /// microcosm // W08F4.3.2 // W08F4.3 /// microcosm // W09D6.4 // W09D6.4 /// microcosm // W10C8.4b // W10C8.4 /// microcosm // Y102A5C.13 // fbxa-112 /// microcosm // Y102A5C.32 // sri-69 /// microcosm // Y102A5C.9 // Y102A5C.9 /// microcosm // Y105C5A.23 // Y105C5A.23 /// microcosm // Y105C5B.9 // Y105C5B.9 /// microcosm // Y106G6H.12 // duo-3 /// microcosm // Y110A7A.21 // Y110A7A.21 /// microcosm // Y116F11B.3.1 // pcp-4 /// microcosm // Y14H12A.1 // Y14H12A.1 /// microcosm // Y17G9B.2 // Y17G9B.2 /// microcosm // Y19D10A.16 // Y19D10A.16 /// microcosm // Y25C1A.3 // Y25C1A.3 /// microcosm // Y37D8A.19.3 // Y37D8A.19 /// microcosm // Y37E11B.9 // Y37E11B.9 /// microcosm // Y38C1AA.4 // tcl-2 /// microcosm // Y38F1A.5.3 // cyd-1 /// microcosm // Y38H6C.12 // srh-166 /// microcosm // Y39A1A.10 // Y39A1A.10 /// microcosm // Y39A1A.5 // rabx-5 /// microcosm // Y39B6A.38 // reps-1 /// microcosm // Y39G10AR.8.1 // Y39G10AR.8 /// microcosm // Y39G10AR.8.2 // Y39G10AR.8 /// microcosm // Y39H10A.3a.2 // mtm-9 /// microcosm // Y39H10A.3b // mtm-9 /// microcosm // Y40G12A.2 // ubh-2 /// microcosm // Y41D4A.2 // col-108 /// microcosm // Y41D4B.26 // nhr-146 /// microcosm // Y41E3.10.1 // Y41E3.10 /// microcosm // Y41E3.10.2 // Y41E3.10 /// microcosm // Y41G9A.4b // Y41G9A.4 /// microcosm // Y43B11AR.4.1 // rps-4 /// microcosm // Y43F4A.1a // Y43F4A.1 /// microcosm // Y43F8B.3 // Y43F8B.3 /// microcosm // Y43F8C.10 // dmd-3 /// microcosm // Y44A6D.1 // Y44A6D.1 /// microcosm // Y45F10A.4 // Y45F10A.4 /// microcosm // Y45G12B.2b // Y45G12B.2 /// microcosm // Y45G5AM.1b // nhr-114 /// microcosm // Y45G5AM.7 // Y45G5AM.7 /// microcosm // Y46E12A.4 // Y46E12A.4 /// microcosm // Y47D3A.2 // fbxa-128 /// microcosm // Y47D7A.10 // Y47D7A.10 /// microcosm // Y47G6A.20b // rnp-6 /// microcosm // Y47G7B.1 // srh-128 /// microcosm // Y48G8AL.1 // Y48G8AL.1 /// microcosm // Y48G8AL.10 // Y48G8AL.10 /// microcosm // Y48G8AR.3 // Y48G8AR.3 /// microcosm // Y4C6A.2a // mgl-3 /// microcosm // Y51H4A.2 // Y51H4A.2 /// microcosm // Y51H4A.6 // Y51H4A.6 /// microcosm // Y51H7C.8 // Y51H7C.8 /// microcosm // Y52B11B.1 // Y52B11B.1 /// microcosm // Y52D5A.1 // Y52D5A.1 /// microcosm // Y53C10A.2 // Y53C10A.2 /// microcosm // Y53C12A.2.1 // glt-5 /// microcosm // Y53C12B.5b // mab-3 /// microcosm // Y53G8B.1 // Y53G8B.1 /// microcosm // Y53H1A.2 // Y53H1A.2 /// microcosm // Y54E10A.11 // Y54E10A.11 /// microcosm // Y54G11A.3.1 // Y54G11A.3 /// microcosm // Y54G2A.41 // Y54G2A.41 /// microcosm // Y54G9A.4 // Y54G9A.4 /// microcosm // Y55D9A.2b // Y55D9A.2 /// microcosm // Y55F3AM.10 // Y55F3AM.10 /// microcosm // Y57G11C.17 // hhat-2 /// microcosm // Y59E1B.2 // Y59E1B.2 /// microcosm // Y60A3A.21 // Y60A3A.21 /// microcosm // Y64G10A.10 // Y64G10A.10 /// microcosm // Y64G10A.6 // Y64G10A.6 /// microcosm // Y66C5A.2 // Y66C5A.2 /// microcosm // Y66H1B.5 // Y66H1B.5 /// microcosm // Y67A10A.8 // Y67A10A.8 /// microcosm // Y67D8C.10a // mca-3 /// microcosm // Y69H2.2 // Y69H2.2 /// microcosm // Y6E2A.9b // Y6E2A.9 /// microcosm // Y71F9AL.2 // Y71F9AL.2 /// microcosm // Y71F9B.8 // Y71F9B.8 /// microcosm // Y71H2AM.20a.1 // Y71H2AM.20 /// microcosm // Y75B7AL.2 // Y75B7AL.2 /// microcosm // Y76A2A.1 // tag-164 /// microcosm // Y80D3A.9 // Y80D3A.9 /// microcosm // Y81G3A.1 // Y81G3A.1 /// microcosm // Y82E9BL.4 // fbxa-25 /// microcosm // Y82E9BR.20 // Y82E9BR.20 /// microcosm // Y87G2A.11 // Y87G2A.11 /// microcosm // Y92H12A.4 // Y92H12A.4 /// microcosm // Y94H6A.7 // Y94H6A.7 /// microcosm // Y95B8A.10 // pde-6 /// microcosm // ZC15.1 // ZC15.1 /// microcosm // ZC196.8 // ZC196.8 /// microcosm // ZC317.5 // srg-68 /// microcosm // ZC477.3a // ZC477.3 /// microcosm // ZK1037.3 // srt-22 /// microcosm // ZK1037.5 // nhr-247 /// microcosm // ZK1086.2 // ZK1086.2 /// microcosm // ZK112.5 // ZK112.5 /// microcosm // ZK1307.9 // ZK1307.9 /// microcosm // ZK270.1 // ptr-23 /// microcosm // ZK370.5.1 // ZK370.5 /// microcosm // ZK380.1 // tbx-32 /// microcosm // ZK430.5 // ZK430.5 /// microcosm // ZK455.7 // pgp-3 /// microcosm // ZK512.5.2 // ZK512.5 /// microcosm // ZK54.2a // tps-1 /// microcosm // ZK54.2b.1 // tps-1 /// microcosm // ZK54.2b.2 // tps-1 /// microcosm // ZK54.2b.3 // tps-1 /// microcosm // ZK622.1 // ZK622.1 /// microcosm // ZK652.10 // tag-307 /// microcosm // ZK688.8.2 // gly-3 /// microcosm // ZK792.2.3 // inx-8 /// microcosm // ZK867.3 // spp-22 /// microcosm // ZK909.2g // kin-1 /// microcosm // ZK909.6 // ZK909.6 /// microcosm // ZK930.5 // ZK930.5 /// microcosm // ZK973.3.1 // ZK973.3 /// microcosm // ZK973.3.2 // ZK973.3 miRNA-4_0 May 13, 2014 miRBase cel-miR-37-3p
MIMAT0020305_st 20500016 MIMAT0020305 cel-miR-38-5p miRNA Caenorhabditis elegans II:11537885-11537906 (+) 22 UCCGGUUUUUUCCGUGGUGAUA Y62F5A.14 // sense // exon // 1 /// Y62F5A.4 // sense // exon // 1 /// Y62F5A.5 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) --- miRNA-4_0 May 13, 2014 miRBase cel-miR-38-5p
MIMAT0000009_st 20500017 MIMAT0000009 cel-miR-38-3p miRNA Caenorhabditis elegans II:11537926-11537947 (+) 22 UCACCGGGAGAAAAACUGGAGU Y62F5A.14 // sense // exon // 1 /// Y62F5A.4 // sense // exon // 1 /// Y62F5A.5 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) MTI // --- // W06H8.5 /// microcosm // AH10.4 // AH10.4 /// microcosm // B0024.13a // B0024.13 /// microcosm // B0034.2 // B0034.2 /// microcosm // B0035.3 // B0035.3 /// microcosm // B0047.1a // bath-20 /// microcosm // B0047.1b // bath-20 /// microcosm // B0047.2 // B0047.2 /// microcosm // B0228.7.2 // B0228.7 /// microcosm // B0284.1 // B0284.1 /// microcosm // B0336.1.1 // wrm-1 /// microcosm // B0336.1.2 // wrm-1 /// microcosm // B0336.3 // B0336.3 /// microcosm // B0432.1 // B0432.1 /// microcosm // B0454.6 // B0454.6 /// microcosm // B0491.8a // clh-2 /// microcosm // B0491.8b // clh-2 /// microcosm // B0491.8c // clh-2 /// microcosm // B0563.8 // B0563.8 /// microcosm // C01B10.8.2 // C01B10.8 /// microcosm // C01G5.7 // C01G5.7 /// microcosm // C02B8.2 // C02B8.2 /// microcosm // C03C10.4 // C03C10.4 /// microcosm // C03C11.1 // C03C11.1 /// microcosm // C03E10.4 // gly-20 /// microcosm // C03G6.5 // C03G6.5 /// microcosm // C04C11.2.2 // C04C11.2 /// microcosm // C04E6.7 // C04E6.7 /// microcosm // C04F12.4.1 // rpl-14 /// microcosm // C04F5.2 // C04F5.2 /// microcosm // C05D2.5 // gak-1 /// microcosm // C05G5.2 // C05G5.2 /// microcosm // C06A6.4a.1 // C06A6.4 /// microcosm // C06A6.4b // C06A6.4 /// microcosm // C06E1.3 // C06E1.3 /// microcosm // C08F8.2a // C08F8.2 /// microcosm // C08F8.2b.1 // C08F8.2 /// microcosm // C09D1.2 // C09D1.2 /// microcosm // C09G1.2 // C09G1.2 /// microcosm // C09G12.3 // srz-78 /// microcosm // C09G12.9 // C09G12.9 /// microcosm // C09G9.7 // C09G9.7 /// microcosm // C14C6.5 // C14C6.5 /// microcosm // C15A11.1 // col-35 /// microcosm // C15C7.6 // C15C7.6 /// microcosm // C16C8.2 // C16C8.2 /// microcosm // C17E7.2 // srh-190 /// microcosm // C17F4.10 // srz-67 /// microcosm // C17H1.8 // C17H1.8 /// microcosm // C18F3.2d // sax-7 /// microcosm // C23F12.2 // flna-2 /// microcosm // C23G10.2a.2 // C23G10.2 /// microcosm // C24A11.8b // frm-4 /// microcosm // C24D10.5 // C24D10.5 /// microcosm // C24H10.5 // uvt-2 /// microcosm // C25D7.8 // C25D7.8 /// microcosm // C26B9.2 // C26B9.2 /// microcosm // C27A2.2a.3 // rpl-22 /// microcosm // C27D6.3 // C27D6.3 /// microcosm // C29G2.3 // C29G2.3 /// microcosm // C30F12.2.1 // C30F12.2 /// microcosm // C30F12.2.2 // C30F12.2 /// microcosm // C32F10.1a.1 // obr-4 /// microcosm // C32F10.1a.2 // obr-4 /// microcosm // C34B7.3 // cyp-36A1 /// microcosm // C34D4.4a // C34D4.4 /// microcosm // C34F11.9a // dsh-1 /// microcosm // C34F11.9b // dsh-1 /// microcosm // C34F6.11 // C34F6.11 /// microcosm // C34G6.1 // C34G6.1 /// microcosm // C35A11.1 // C35A11.1 /// microcosm // C35B1.1.1 // ubc-1 /// microcosm // C36A4.2 // cyp-25A2 /// microcosm // C36B1.5.2 // C36B1.5 /// microcosm // C36C5.14 // C36C5.14 /// microcosm // C37H5.13c // C37H5.13 /// microcosm // C39D10.11 // C39D10.11 /// microcosm // C39E9.8a // C39E9.8 /// microcosm // C39E9.8b // C39E9.8 /// microcosm // C41A3.1 // C41A3.1 /// microcosm // C41D11.2 // eif-3.H /// microcosm // C41D11.8.1 // cps-6 /// microcosm // C41D11.8.2 // cps-6 /// microcosm // C41G11.4a // C41G11.4 /// microcosm // C41G11.4b // C41G11.4 /// microcosm // C41G11.4c // C41G11.4 /// microcosm // C44F1.5 // acy-3 /// microcosm // C46F4.1 // C46F4.1 /// microcosm // C48E7.8 // C48E7.8 /// microcosm // C50F4.1.1 // C50F4.1 /// microcosm // C52E12.2a.1 // unc-104 /// microcosm // C52E12.2a.2 // unc-104 /// microcosm // C52E12.4 // C52E12.4 /// microcosm // C54F6.12 // C54F6.12 /// microcosm // C55A6.11 // C55A6.11 /// microcosm // C56A3.7 // cav-2 /// microcosm // D1014.1 // sul-2 /// microcosm // D1046.5 // D1046.5 /// microcosm // D1053.2 // D1053.2 /// microcosm // D1053.3 // D1053.3 /// microcosm // D1081.3 // D1081.3 /// microcosm // D2024.10 // D2024.10 /// microcosm // D2024.2 // D2024.2 /// microcosm // D2096.8 // D2096.8 /// microcosm // E01H11.1b // pkc-2 /// microcosm // E02A10.3 // E02A10.3 /// microcosm // E02H1.5.2 // E02H1.5 /// microcosm // E03H12.10.2 // ssp-9 /// microcosm // E03H4.11 // E03H4.11 /// microcosm // F01F1.13 // F01F1.13 /// microcosm // F07F6.1 // F07F6.1 /// microcosm // F07G11.4 // F07G11.4 /// microcosm // F10G7.12 // F10G7.12 /// microcosm // F10G7.2.2 // tsn-1 /// microcosm // F10G7.9a // F10G7.9 /// microcosm // F10G7.9b.1 // F10G7.9 /// microcosm // F12E12.2 // F12E12.2 /// microcosm // F12F6.10 // --- /// microcosm // F13A7.13 // sre-36 /// microcosm // F13D12.8 // F13D12.8 /// microcosm // F13E9.1 // F13E9.1 /// microcosm // F14F8.9 // F14F8.9 /// microcosm // F14H12.1 // col-165 /// microcosm // F15A2.6a // sad-1 /// microcosm // F15D3.2 // F15D3.2 /// microcosm // F15H9.4 // sri-16 /// microcosm // F16D3.7 // F16D3.7 /// microcosm // F16H6.5 // F16H6.5 /// microcosm // F17C11.9b.1 // F17C11.9 /// microcosm // F17C11.9c.2 // F17C11.9 /// microcosm // F18C12.2a // rme-8 /// microcosm // F18C12.2b // rme-8 /// microcosm // F19D8.2 // F19D8.2 /// microcosm // F19H8.4 // F19H8.4 /// microcosm // F20A1.4 // F20A1.4 /// microcosm // F20B6.3 // mrp-6 /// microcosm // F20B6.6 // F20B6.6 /// microcosm // F20C5.3 // F20C5.3 /// microcosm // F20D6.5 // F20D6.5 /// microcosm // F21H12.3 // F21H12.3 /// microcosm // F22B5.9.1 // frs-2 /// microcosm // F22B5.9.2 // frs-2 /// microcosm // F22D6.11 // gly-18 /// microcosm // F22D6.2.2 // F22D6.2 /// microcosm // F23B12.9 // egl-1 /// microcosm // F23H12.1 // snb-2 /// microcosm // F25B3.1 // F25B3.1 /// microcosm // F25D1.4 // F25D1.4 /// microcosm // F25E5.7 // F25E5.7 /// microcosm // F25E5.9 // F25E5.9 /// microcosm // F25G6.6 // nrs-2 /// microcosm // F25H2.5.4 // F25H2.5 /// microcosm // F25H2.5.5 // F25H2.5 /// microcosm // F25H2.5.6 // F25H2.5 /// microcosm // F25H9.3 // F25H9.3 /// microcosm // F26F4.7 // nhl-2 /// microcosm // F27E5.5 // F27E5.5 /// microcosm // F28A10.1 // F28A10.1 /// microcosm // F28D1.4 // thn-3 /// microcosm // F28E10.4 // F28E10.4 /// microcosm // F28G4.4 // F28G4.4 /// microcosm // F29B9.8.1 // F29B9.8 /// microcosm // F29B9.8.2 // F29B9.8 /// microcosm // F31A9.4 // F31A9.4 /// microcosm // F32D8.1 // F32D8.1 /// microcosm // F32E10.8 // F32E10.8 /// microcosm // F33H1.2.2 // gpd-4 /// microcosm // F35D6.1a // fem-1 /// microcosm // F35E12.4 // F35E12.4 /// microcosm // F35F10.7 // F35F10.7 /// microcosm // F35H10.4.1 // vha-5 /// microcosm // F35H10.4.2 // vha-5 /// microcosm // F36A4.2 // F36A4.2 /// microcosm // F36G9.5 // sru-22 /// microcosm // F36G9.6 // sru-23 /// microcosm // F36H5.3b // math-28 /// microcosm // F36H5.9 // F36H5.9 /// microcosm // F37A4.7c // rbf-1 /// microcosm // F37C12.17 // srb-7 /// microcosm // F37C12.4.2 // rpl-36 /// microcosm // F38H12.3 // nhr-181 /// microcosm // F39B2.2.1 // uev-1 /// microcosm // F39B2.2.2 // uev-1 /// microcosm // F39E9.7 // F39E9.7 /// microcosm // F39F10.2 // F39F10.2 /// microcosm // F39H11.5.1 // pbs-7 /// microcosm // F40A3.6 // F40A3.6 /// microcosm // F40B5.3 // F40B5.3 /// microcosm // F40D4.1 // srh-174 /// microcosm // F40D4.7 // srbc-26 /// microcosm // F40F8.5 // F40F8.5 /// microcosm // F40F9.2 // tag-120 /// microcosm // F40G9.14 // F40G9.14 /// microcosm // F41B4.1 // F41B4.1 /// microcosm // F41D3.10 // F41D3.10 /// microcosm // F41D3.5 // F41D3.5 /// microcosm // F41D3.6 // F41D3.6 /// microcosm // F41D3.7 // F41D3.7 /// microcosm // F41D9.3b.1 // wrk-1 /// microcosm // F41D9.3b.2 // wrk-1 /// microcosm // F41D9.3c // wrk-1 /// microcosm // F43E2.4 // haf-2 /// microcosm // F43G6.1b // dna-2 /// microcosm // F44B9.8 // F44B9.8 /// microcosm // F44C8.5b // nhr-128 /// microcosm // F45E12.5a // F45E12.5 /// microcosm // F45E6.4 // F45E6.4 /// microcosm // F45G2.1 // nas-1 /// microcosm // F45H7.2b // gei-1 /// microcosm // F46A8.5 // F46A8.5 /// microcosm // F46A8.8 // F46A8.8 /// microcosm // F47B10.6 // F47B10.6 /// microcosm // F47F2.1b // F47F2.1 /// microcosm // F47F2.1c.1 // F47F2.1 /// microcosm // F47G4.3 // gpdh-1 /// microcosm // F47G6.2 // F47G6.2 /// microcosm // F47G9.3 // F47G9.3 /// microcosm // F48B9.3 // F48B9.3 /// microcosm // F48E8.6 // F48E8.6 /// microcosm // F48G7.12 // F48G7.12 /// microcosm // F49E11.2 // F49E11.2 /// microcosm // F49F1.7 // F49F1.7 /// microcosm // F52E1.9 // F52E1.9 /// microcosm // F52F12.6 // ekl-2 /// microcosm // F53A9.10b.3 // tnt-2 /// microcosm // F53A9.10b.4 // tnt-2 /// microcosm // F53G2.4b // pqn-42 /// microcosm // F54F3.4 // F54F3.4 /// microcosm // F54G8.5 // ptr-9 /// microcosm // F55A12.10 // F55A12.10 /// microcosm // F55A4.8a // F55A4.8 /// microcosm // F55D10.4 // F55D10.4 /// microcosm // F56B3.11a // F56B3.11 /// microcosm // F56C11.5 // F56C11.5 /// microcosm // F57B1.8 // F57B1.8 /// microcosm // F57B10.7 // tre-1 /// microcosm // F57B7.4 // mig-17 /// microcosm // F58E1.2 // fbxb-25 /// microcosm // F58E10.1a // F58E10.1 /// microcosm // F58E10.1b // F58E10.1 /// microcosm // F58E6.6 // F58E6.6 /// microcosm // F58G6.2 // srm-3 /// microcosm // F59B2.7 // rab-6.1 /// microcosm // F59C6.3 // F59C6.3 /// microcosm // F59D6.3 // F59D6.3 /// microcosm // H05C05.1a // H05C05.1 /// microcosm // H06A10.1 // H06A10.1 /// microcosm // H06H21.3.1 // H06H21.3 /// microcosm // H06H21.3.2 // H06H21.3 /// microcosm // H09I01.1 // H09I01.1 /// microcosm // H10D18.4 // H10D18.4 /// microcosm // H10E21.5 // H10E21.5 /// microcosm // H12D21.10 // H12D21.10 /// microcosm // H19M22.2a // let-805 /// microcosm // H19M22.2c // let-805 /// microcosm // H20J04.9 // H20J04.9 /// microcosm // H21P03.1 // mbf-1 /// microcosm // K02B12.7 // K02B12.7 /// microcosm // K02D10.4 // K02D10.4 /// microcosm // K02E10.7 // K02E10.7 /// microcosm // K02E10.8 // syg-1 /// microcosm // K02E11.5 // K02E11.5 /// microcosm // K02E7.9 // K02E7.9 /// microcosm // K02F2.6 // ser-3 /// microcosm // K03B8.11 // K03B8.11 /// microcosm // K07E12.1a // dig-1 /// microcosm // K07F5.14 // K07F5.14 /// microcosm // K07H8.10.1 // K07H8.10 /// microcosm // K07H8.10.2 // K07H8.10 /// microcosm // K07H8.8 // K07H8.8 /// microcosm // K07H8.9 // K07H8.9 /// microcosm // K08B4.5 // K08B4.5 /// microcosm // K08D9.5 // K08D9.5 /// microcosm // K08E3.2 // K08E3.2 /// microcosm // K08F11.5.1 // K08F11.5 /// microcosm // K08F11.5.2 // K08F11.5 /// microcosm // K08F4.3 // K08F4.3 /// microcosm // K08F8.3.1 // fut-1 /// microcosm // K08F8.3.2 // fut-1 /// microcosm // K09F6.10 // K09F6.10 /// microcosm // K10B3.1a // K10B3.1 /// microcosm // K10C2.6 // K10C2.6 /// microcosm // K11D9.1a // klp-7 /// microcosm // K11D9.1b.2 // klp-7 /// microcosm // K11E4.3 // K11E4.3 /// microcosm // K11G9.4 // egl-46 /// microcosm // K12D12.4a // K12D12.4 /// microcosm // K12H4.7b.2 // K12H4.7 /// microcosm // M01D1.9 // fbxb-40 /// microcosm // M01F1.4a // M01F1.4 /// microcosm // M01F1.4b // M01F1.4 /// microcosm // M02E1.1a.1 // M02E1.1 /// microcosm // M02E1.1a.2 // M02E1.1 /// microcosm // M03F8.1 // M03F8.1 /// microcosm // M05B5.4 // M05B5.4 /// microcosm // PAR2.3a // aak-1 /// microcosm // PAR2.3b.2 // aak-1 /// microcosm // R05H11.2 // R05H11.2 /// microcosm // R06C1.3 // wve-1 /// microcosm // R07C3.12 // clec-44 /// microcosm // R10E4.2a.1 // tag-310 /// microcosm // R10F2.4 // R10F2.4 /// microcosm // R11D1.11 // dhs-21 /// microcosm // R11D1.1b.1 // R11D1.1 /// microcosm // R11E3.2 // R11E3.2 /// microcosm // R11G11.3 // R11G11.3 /// microcosm // R12B2.1a.3 // sma-4 /// microcosm // R13H8.1e.1 // daf-16 /// microcosm // R144.7a // larp-1 /// microcosm // R148.3a // R148.3 /// microcosm // R160.5 // R160.5 /// microcosm // T02C12.1.1 // hum-5 /// microcosm // T02C12.1.2 // hum-5 /// microcosm // T03D8.4 // grl-14 /// microcosm // T03G6.3.1 // T03G6.3 /// microcosm // T04A8.9.2 // dnj-18 /// microcosm // T04B8.1 // T04B8.1 /// microcosm // T04D3.1 // T04D3.1 /// microcosm // T04F3.2 // T04F3.2 /// microcosm // T04H1.7 // ugt-55 /// microcosm // T05B11.7 // T05B11.7 /// microcosm // T05C1.4a // T05C1.4 /// microcosm // T05C1.4b // T05C1.4 /// microcosm // T05C1.4c // T05C1.4 /// microcosm // T05F1.5 // T05F1.5 /// microcosm // T06E4.5 // T06E4.5 /// microcosm // T06G6.7 // srw-88 /// microcosm // T07F8.3b.1 // gld-3 /// microcosm // T08G3.3 // srh-142 /// microcosm // T09F3.3.3 // gpd-1 /// microcosm // T10B10.3.2 // T10B10.3 /// microcosm // T11A5.6 // T11A5.6 /// microcosm // T12F5.4 // lin-59 /// microcosm // T13H5.3 // T13H5.3 /// microcosm // T13H5.7 // rnh-2 /// microcosm // T14B1.2 // T14B1.2 /// microcosm // T14E8.2 // T14E8.2 /// microcosm // T17H7.4g.1 // gei-16 /// microcosm // T17H7.4k.2 // gei-16 /// microcosm // T18D3.6 // T18D3.6 /// microcosm // T18H9.5a // inx-10 /// microcosm // T19B10.8 // T19B10.8 /// microcosm // T19C3.8 // fem-2 /// microcosm // T19H12.4 // srd-33 /// microcosm // T20B12.1 // T20B12.1 /// microcosm // T20F7.5 // T20F7.5 /// microcosm // T22C1.3 // T22C1.3 /// microcosm // T22F3.11a // T22F3.11 /// microcosm // T22H2.5a.1 // plsc-2 /// microcosm // T22H2.5a.2 // plsc-2 /// microcosm // T23B12.11 // T23B12.11 /// microcosm // T23B3.6 // T23B3.6 /// microcosm // T23G5.2b.2 // T23G5.2 /// microcosm // T24A11.3 // toh-1 /// microcosm // T25B9.6 // T25B9.6 /// microcosm // T26A8.1.1 // T26A8.1 /// microcosm // T26A8.1.2 // T26A8.1 /// microcosm // T26A8.1.3 // T26A8.1 /// microcosm // T26E3.10 // T26E3.10 /// microcosm // T26H8.3 // srx-49 /// microcosm // T27D12.2a // clh-1 /// microcosm // T27D12.2b // clh-1 /// microcosm // T27E9.7.2 // T27E9.7 /// microcosm // T28A11.10 // srj-7 /// microcosm // T28C12.4a // T28C12.4 /// microcosm // T28C12.4b // T28C12.4 /// microcosm // T28D6.5a // T28D6.5 /// microcosm // T28D6.5b // T28D6.5 /// microcosm // T28F2.2 // T28F2.2 /// microcosm // T28H10.4 // T28H10.4 /// microcosm // W01A8.8 // W01A8.8 /// microcosm // W01B6.7 // col-2 /// microcosm // W02D7.9 // W02D7.9 /// microcosm // W02D9.8 // W02D9.8 /// microcosm // W03F8.10 // W03F8.10 /// microcosm // W06D11.1 // W06D11.1 /// microcosm // W07G4.2 // W07G4.2 /// microcosm // W08E12.8 // W08E12.8 /// microcosm // W10C8.4b // W10C8.4 /// microcosm // Y102A5C.9 // Y102A5C.9 /// microcosm // Y105C5A.23 // Y105C5A.23 /// microcosm // Y105C5B.9 // Y105C5B.9 /// microcosm // Y110A7A.18 // ppw-2 /// microcosm // Y110A7A.21 // Y110A7A.21 /// microcosm // Y111B2A.20 // Y111B2A.20 /// microcosm // Y116A8C.29 // Y116A8C.29 /// microcosm // Y116F11B.3.1 // pcp-4 /// microcosm // Y14H12A.1 // Y14H12A.1 /// microcosm // Y17G9A.7b // str-174 /// microcosm // Y22D7AR.13.1 // ser-4 /// microcosm // Y22D7AR.13.2 // ser-4 /// microcosm // Y22D7AR.2 // Y22D7AR.2 /// microcosm // Y24D9A.8a.2 // Y24D9A.8 /// microcosm // Y38E10A.4 // clec-8 /// microcosm // Y38F1A.5.3 // cyd-1 /// microcosm // Y39A1A.5 // rabx-5 /// microcosm // Y39B6A.38 // reps-1 /// microcosm // Y39D8B.1 // Y39D8B.1 /// microcosm // Y41C4A.7 // Y41C4A.7 /// microcosm // Y41D4A.2 // col-108 /// microcosm // Y41D4B.26 // nhr-146 /// microcosm // Y43B11AR.4.1 // rps-4 /// microcosm // Y43F4A.1a // Y43F4A.1 /// microcosm // Y43F8C.10 // dmd-3 /// microcosm // Y44A6D.4 // sdf-9 /// microcosm // Y46D2A.2 // Y46D2A.2 /// microcosm // Y47D3A.23b // gly-9 /// microcosm // Y47D7A.16 // Y47D7A.16 /// microcosm // Y47G6A.20b // rnp-6 /// microcosm // Y47G6A.21.2 // Y47G6A.21 /// microcosm // Y48C3A.12 // Y48C3A.12 /// microcosm // Y49C4A.5 // srx-4 /// microcosm // Y4C6A.2a // mgl-3 /// microcosm // Y51H4A.6 // Y51H4A.6 /// microcosm // Y52B11B.1 // Y52B11B.1 /// microcosm // Y52D5A.1 // Y52D5A.1 /// microcosm // Y53C10A.2 // Y53C10A.2 /// microcosm // Y53C12A.2.1 // glt-5 /// microcosm // Y53C12B.5b // mab-3 /// microcosm // Y53G8B.1 // Y53G8B.1 /// microcosm // Y53H1A.2 // Y53H1A.2 /// microcosm // Y54E10A.11 // Y54E10A.11 /// microcosm // Y54E2A.11a.2 // eif-3.B /// microcosm // Y54E5B.1a // smp-1 /// microcosm // Y54F10AM.10 // rbc-2 /// microcosm // Y54G11A.3.1 // Y54G11A.3 /// microcosm // Y54G11A.3.2 // Y54G11A.3 /// microcosm // Y54G2A.31 // ubc-13 /// microcosm // Y54G9A.4 // Y54G9A.4 /// microcosm // Y55D9A.1a // Y55D9A.1 /// microcosm // Y55F3AM.10 // Y55F3AM.10 /// microcosm // Y56A3A.18.1 // Y56A3A.18 /// microcosm // Y60A3A.21 // Y60A3A.21 /// microcosm // Y64G10A.10 // Y64G10A.10 /// microcosm // Y64G10A.6 // Y64G10A.6 /// microcosm // Y66C5A.2 // Y66C5A.2 /// microcosm // Y66H1B.2a // Y66H1B.2 /// microcosm // Y66H1B.2b.1 // Y66H1B.2 /// microcosm // Y66H1B.2b.2 // Y66H1B.2 /// microcosm // Y67A10A.8 // Y67A10A.8 /// microcosm // Y67D8C.10a // mca-3 /// microcosm // Y67D8C.10c // mca-3 /// microcosm // Y69A2AR.18a.1 // Y69A2AR.18 /// microcosm // Y69A2AR.18a.3 // Y69A2AR.18 /// microcosm // Y69A2AR.18b.1 // Y69A2AR.18 /// microcosm // Y69H2.9 // Y69H2.9 /// microcosm // Y6E2A.9b // Y6E2A.9 /// microcosm // Y71F9AL.17 // Y71F9AL.17 /// microcosm // Y71F9B.8 // Y71F9B.8 /// microcosm // Y71H9A.2 // sto-6 /// microcosm // Y73E7A.5 // Y73E7A.5 /// microcosm // Y75B7AL.2 // Y75B7AL.2 /// microcosm // Y75B8A.24 // Y75B8A.24 /// microcosm // Y75B8A.32 // Y75B8A.32 /// microcosm // Y76A2B.1 // pod-1 /// microcosm // Y77E11A.3 // Y77E11A.3 /// microcosm // Y81G3A.1 // Y81G3A.1 /// microcosm // Y82E9BR.20 // Y82E9BR.20 /// microcosm // Y87G2A.11 // Y87G2A.11 /// microcosm // Y95B8A.10 // pde-6 /// microcosm // ZC15.1 // ZC15.1 /// microcosm // ZC155.7 // syn-16 /// microcosm // ZC168.2 // ZC168.2 /// microcosm // ZC239.12 // sdz-35 /// microcosm // ZC239.8 // sri-51 /// microcosm // ZC317.5 // srg-68 /// microcosm // ZC404.1 // ZC404.1 /// microcosm // ZC477.3a // ZC477.3 /// microcosm // ZC482.6 // srw-10 /// microcosm // ZC518.1b // ZC518.1 /// microcosm // ZK1010.5 // ZK1010.5 /// microcosm // ZK1128.7 // ZK1128.7 /// microcosm // ZK1251.7 // sdz-36 /// microcosm // ZK1307.9 // ZK1307.9 /// microcosm // ZK1321.2c // ZK1321.2 /// microcosm // ZK1321.2f.2 // ZK1321.2 /// microcosm // ZK154.6a // ZK154.6 /// microcosm // ZK154.6b // ZK154.6 /// microcosm // ZK180.1 // ZK180.1 /// microcosm // ZK20.5.1 // rpn-12 /// microcosm // ZK20.5.2 // rpn-12 /// microcosm // ZK262.9 // ZK262.9 /// microcosm // ZK270.1 // ptr-23 /// microcosm // ZK370.5.1 // ZK370.5 /// microcosm // ZK381.2 // ZK381.2 /// microcosm // ZK381.5a // ZK381.5 /// microcosm // ZK381.5b // ZK381.5 /// microcosm // ZK430.5 // ZK430.5 /// microcosm // ZK54.2a // tps-1 /// microcosm // ZK54.2b.1 // tps-1 /// microcosm // ZK54.2b.2 // tps-1 /// microcosm // ZK54.2b.3 // tps-1 /// microcosm // ZK637.8a // unc-32 /// microcosm // ZK637.8c // unc-32 /// microcosm // ZK652.10 // tag-307 /// microcosm // ZK673.1 // ZK673.1 /// microcosm // ZK688.8.1 // gly-3 /// microcosm // ZK688.8.2 // gly-3 /// microcosm // ZK792.2.3 // inx-8 /// microcosm // ZK849.5 // ZK849.5 /// microcosm // ZK863.8 // ZK863.8 /// microcosm // ZK867.3 // spp-22 /// microcosm // ZK909.6 // ZK909.6 miRNA-4_0 May 13, 2014 miRBase cel-miR-38-3p
MIMAT0020306_st 20500018 MIMAT0020306 cel-miR-39-5p miRNA Caenorhabditis elegans II:11538039-11538060 (+) 22 AGCUGAUUUCGUCUUGGUAAUA Y62F5A.15 // sense // exon // 1 /// Y62F5A.5 // sense // exon // 1 /// Y62F5A.6 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) --- miRNA-4_0 May 13, 2014 miRBase cel-miR-39-5p
MIMAT0000010_st 20500019 MIMAT0000010 cel-miR-39-3p miRNA Caenorhabditis elegans II:11538079-11538100 (+) 22 UCACCGGGUGUAAAUCAGCUUG Y62F5A.15 // sense // exon // 1 /// Y62F5A.5 // sense // exon // 1 /// Y62F5A.6 // sense // exon // 1 /// Y62F5A.9 // antisense // intron // 2 cel-mir-35 // II:11537544-11537640 (+) /// cel-mir-36 // II:11537649-11537745 (+) /// cel-mir-37 // II:11537769-11537866 (+) /// cel-mir-38 // II:11537869-11537963 (+) /// cel-mir-39 // II:11538025-11538111 (+) /// cel-mir-40 // II:11538120-11538211 (+) /// cel-mir-41 // II:11538244-11538340 (+) MTI // --- // W06H8.5 /// microcosm // AH10.4 // AH10.4 /// microcosm // B0034.2 // B0034.2 /// microcosm // B0035.3 // B0035.3 /// microcosm // B0047.1a // bath-20 /// microcosm // B0047.2 // B0047.2 /// microcosm // B0228.7.2 // B0228.7 /// microcosm // B0336.1.1 // wrm-1 /// microcosm // B0336.1.2 // wrm-1 /// microcosm // B0403.3 // B0403.3 /// microcosm // B0403.5 // B0403.5 /// microcosm // B0416.1 // B0416.1 /// microcosm // B0432.1 // B0432.1 /// microcosm // B0496.5 // B0496.5 /// microcosm // C01B4.6 // C01B4.6 /// microcosm // C01B9.1 // C01B9.1 /// microcosm // C01G5.7 // C01G5.7 /// microcosm // C02B8.2 // C02B8.2 /// microcosm // C02F5.9.1 // pbs-6 /// microcosm // C03A3.3 // C03A3.3 /// microcosm // C03C10.5 // C03C10.5 /// microcosm // C03G5.2 // nspc-7 /// microcosm // C04C11.2.1 // C04C11.2 /// microcosm // C04C11.2.2 // C04C11.2 /// microcosm // C05B5.3 // pqn-8 /// microcosm // C06E1.3 // C06E1.3 /// microcosm // C06E7.2.1 // C06E7.2 /// microcosm // C06E7.2.2 // C06E7.2 /// microcosm // C06E7.6 // spe-27 /// microcosm // C08F8.2a // C08F8.2 /// microcosm // C08F8.2b.1 // C08F8.2 /// microcosm // C08G5.3 // C08G5.3 /// microcosm // C09D8.1c // ptp-3 /// microcosm // C09G1.2 // C09G1.2 /// microcosm // C09G12.3 // srz-78 /// microcosm // C11H1.2 // C11H1.2 /// microcosm // C13A2.1 // C13A2.1 /// microcosm // C14C6.5 // C14C6.5 /// microcosm // C14F11.1b.2 // C14F11.1 /// microcosm // C15C7.6 // C15C7.6 /// microcosm // C15H11.5.1 // tag-338 /// microcosm // C15H11.7.1 // pas-1 /// microcosm // C17E7.2 // srh-190 /// microcosm // C18E9.10 // C18E9.10 /// microcosm // C18F3.2d // sax-7 /// microcosm // C18G1.9 // C18G1.9 /// microcosm // C23F12.2 // flna-2 /// microcosm // C23H5.8b.1 // C23H5.8 /// microcosm // C24A3.8 // C24A3.8 /// microcosm // C24B9.15 // srg-60 /// microcosm // C24B9.6 // srt-27 /// microcosm // C24H10.5 // uvt-2 /// microcosm // C27D6.3 // C27D6.3 /// microcosm // C29F9.5 // C29F9.5 /// microcosm // C29G2.3 // C29G2.3 /// microcosm // C30B5.2a // C30B5.2 /// microcosm // C30B5.2b // C30B5.2 /// microcosm // C30F12.2.1 // C30F12.2 /// microcosm // C30F12.2.2 // C30F12.2 /// microcosm // C30F12.5 // C30F12.5 /// microcosm // C32F10.1a.1 // obr-4 /// microcosm // C32F10.1a.2 // obr-4 /// microcosm // C33B4.3b // shn-1 /// microcosm // C34B2.4 // C34B2.4 /// microcosm // C34D4.4a // C34D4.4 /// microcosm // C34F11.3b // C34F11.3 /// microcosm // C34F11.9a // dsh-1 /// microcosm // C34F11.9b // dsh-1 /// microcosm // C34F6.11 // C34F6.11 /// microcosm // C34G6.1 // C34G6.1 /// microcosm // C34G6.3 // C34G6.3 /// microcosm // C35B1.1.1 // ubc-1 /// microcosm // C36A4.2 // cyp-25A2 /// microcosm // C38C3.4a // C38C3.4 /// microcosm // C39D10.11 // C39D10.11 /// microcosm // C40A11.4 // C40A11.4 /// microcosm // C41A3.1 // C41A3.1 /// microcosm // C41D11.2 // eif-3.H /// microcosm // C41D11.8.1 // cps-6 /// microcosm // C41D11.8.2 // cps-6 /// microcosm // C42C1.3 // C42C1.3 /// microcosm // C44B7.3 // C44B7.3 /// microcosm // C44C1.5b.2 // C44C1.5 /// microcosm // C44C10.8 // hnd-1 /// microcosm // C44F1.5 // acy-3 /// microcosm // C44H9.6.1 // C44H9.6 /// microcosm // C44H9.6.2 // C44H9.6 /// microcosm // C48D1.3 // cho-1 /// microcosm // C49C8.6 // C49C8.6 /// microcosm // C50B6.10 // str-4 /// microcosm // C50F4.1.1 // C50F4.1 /// microcosm // C51E3.7a.1 // egl-3 /// microcosm // C51E3.7a.2 // egl-3 /// microcosm // C51E3.7b.2 // egl-3 /// microcosm // C54F6.12 // C54F6.12 /// microcosm // C55A6.11 // C55A6.11 /// microcosm // C56A3.7 // cav-2 /// microcosm // CD4.8 // CD4.8 /// microcosm // D1037.2 // smp-2 /// microcosm // D1046.5 // D1046.5 /// microcosm // D1053.2 // D1053.2 /// microcosm // D1081.3 // D1081.3 /// microcosm // D2024.10 // D2024.10 /// microcosm // D2024.2 // D2024.2 /// microcosm // D2096.8 // D2096.8 /// microcosm // DH11.4 // DH11.4 /// microcosm // E02A10.3 // E02A10.3 /// microcosm // EEED8.14 // EEED8.14 /// microcosm // EGAP798.1 // EGAP798.1 /// microcosm // F01F1.13 // F01F1.13 /// microcosm // F02C9.4 // F02C9.4 /// microcosm // F07A11.1 // F07A11.1 /// microcosm // F07F6.1 // F07F6.1 /// microcosm // F08D12.6 // fbxb-108 /// microcosm // F10A3.6 // str-99 /// microcosm // F10E9.1 // F10E9.1 /// microcosm // F10G7.12 // F10G7.12 /// microcosm // F10G7.2.2 // tsn-1 /// microcosm // F10G7.6 // F10G7.6 /// microcosm // F10G7.9a // F10G7.9 /// microcosm // F10G7.9b.1 // F10G7.9 /// microcosm // F11A6.2 // plsc-4 /// microcosm // F12A10.1 // F12A10.1 /// microcosm // F12A10.6 // F12A10.6 /// microcosm // F13B10.2a.1 // rpl-3 /// microcosm // F13B10.2d.2 // rpl-3 /// microcosm // F13D12.8 // F13D12.8 /// microcosm // F13G3.2 // srd-53 /// microcosm // F14D12.4b // mec-2 /// microcosm // F14D12.4c // mec-2 /// microcosm // F14F8.9 // F14F8.9 /// microcosm // F15A4.7 // srg-17 /// microcosm // F15B9.1 // far-3 /// microcosm // F15D3.2 // F15D3.2 /// microcosm // F15D3.8 // F15D3.8 /// microcosm // F16D3.7 // F16D3.7 /// microcosm // F16H11.4 // ceh-1 /// microcosm // F16H6.5 // F16H6.5 /// microcosm // F17C11.9b.1 // F17C11.9 /// microcosm // F17C11.9c.2 // F17C11.9 /// microcosm // F18A11.1.1 // puf-6 /// microcosm // F19G12.2 // F19G12.2 /// microcosm // F20B6.6 // F20B6.6 /// microcosm // F20D6.5 // F20D6.5 /// microcosm // F21F8.5 // F21F8.5 /// microcosm // F21H7.11 // srh-95 /// microcosm // F22D6.2.2 // F22D6.2 /// microcosm // F23A7.7 // F23A7.7 /// microcosm // F23B12.1 // F23B12.1 /// microcosm // F23B12.9 // egl-1 /// microcosm // F23C8.13.1 // F23C8.13 /// microcosm // F23F12.10 // srb-11 /// microcosm // F23H12.1 // snb-2 /// microcosm // F25B3.1 // F25B3.1 /// microcosm // F25H2.5.4 // F25H2.5 /// microcosm // F25H2.5.5 // F25H2.5 /// microcosm // F25H2.5.6 // F25H2.5 /// microcosm // F26F4.7 // nhl-2 /// microcosm // F27E5.5 // F27E5.5 /// microcosm // F28D1.4 // thn-3 /// microcosm // F28E10.4 // F28E10.4 /// microcosm // F29B9.8.1 // F29B9.8 /// microcosm // F29B9.8.2 // F29B9.8 /// microcosm // F29D10.3 // F29D10.3 /// microcosm // F31A9.4 // F31A9.4 /// microcosm // F31F4.4 // srx-21 /// microcosm // F32D8.1 // F32D8.1 /// microcosm // F32E10.8 // F32E10.8 /// microcosm // F35D11.3.1 // F35D11.3 /// microcosm // F35D11.3.2 // F35D11.3 /// microcosm // F35E12.4 // F35E12.4 /// microcosm // F35H10.4.1 // vha-5 /// microcosm // F35H10.4.2 // vha-5 /// microcosm // F35H12.1 // F35H12.1 /// microcosm // F36A4.2 // F36A4.2 /// microcosm // F36D4.4 // F36D4.4 /// microcosm // F36F12.7 // F36F12.7 /// microcosm // F36H5.10 // F36H5.10 /// microcosm // F37C12.4.2 // rpl-36 /// microcosm // F38H12.3 // nhr-181 /// microcosm // F39E9.7 // F39E9.7 /// microcosm // F39H11.5.1 // pbs-7 /// microcosm // F40A3.6 // F40A3.6 /// microcosm // F40F12.1 // sdz-17 /// microcosm // F40G9.14 // F40G9.14 /// microcosm // F41D3.10 // F41D3.10 /// microcosm // F41D3.5 // F41D3.5 /// microcosm // F41D3.6 // F41D3.6 /// microcosm // F41D3.7 // F41D3.7 /// microcosm // F41G4.7 // F41G4.7 /// microcosm // F42A8.1 // F42A8.1 /// microcosm // F42G9.9d.1 // ptl-1 /// microcosm // F42G9.9d.2 // ptl-1 /// microcosm // F44B9.8 // F44B9.8 /// microcosm // F44C8.5b // nhr-128 /// microcosm // F44G4.4b // tag-169 /// microcosm // F45E12.5a // F45E12.5 /// microcosm // F45G2.1 // nas-1 /// microcosm // F45H11.1b // sptf-1 /// microcosm // F46A8.5 // F46A8.5 /// microcosm // F46A8.8 // F46A8.8 /// microcosm // F46F5.15 // F46F5.15 /// microcosm // F46F5.4 // F46F5.4 /// microcosm // F46F6.4a // dyf-6 /// microcosm // F47B10.6 // F47B10.6 /// microcosm // F47C12.6 // F47C12.6 /// microcosm // F47D2.1 // srt-19 /// microcosm // F47D2.5 // srt-36 /// microcosm // F47G6.2 // F47G6.2 /// microcosm // F47G9.3 // F47G9.3 /// microcosm // F48G7.12 // F48G7.12 /// microcosm // F49E11.2 // F49E11.2 /// microcosm // F49F1.7 // F49F1.7 /// microcosm // F52F12.6 // ekl-2 /// microcosm // F53A2.6.2 // ife-1 /// microcosm // F53A2.6.3 // ife-1 /// microcosm // F53E10.4 // F53E10.4 /// microcosm // F53F1.10 // srd-18 /// microcosm // F53G2.4b // pqn-42 /// microcosm // F53H10.2 // F53H10.2 /// microcosm // F54C8.1 // F54C8.1 /// microcosm // F54E7.5 // sdz-21 /// microcosm // F54F3.4 // F54F3.4 /// microcosm // F54H12.4 // F54H12.4 /// microcosm // F55A12.10 // F55A12.10 /// microcosm // F55A4.4 // F55A4.4 /// microcosm // F55A4.8a // F55A4.8 /// microcosm // F56B3.2b // F56B3.2 /// microcosm // F56B3.6 // F56B3.6 /// microcosm // F56F10.3 // F56F10.3 /// microcosm // F56F3.5.2 // rps-1 /// microcosm // F57B1.8 // F57B1.8 /// microcosm // F57B7.2 // F57B7.2 /// microcosm // F57B7.4 // mig-17 /// microcosm // F58E10.1a // F58E10.1 /// microcosm // F58E10.1b // F58E10.1 /// microcosm // F58F6.1 // col-104 /// microcosm // F58G11.4 // F58G11.4 /// microcosm // F58G6.2 // srm-3 /// microcosm // F59A7.11 // F59A7.11 /// microcosm // F59B10.4a // F59B10.4 /// microcosm // F59B10.4b // F59B10.4 /// microcosm // F59C6.2 // F59C6.2 /// microcosm // F59C6.3 // F59C6.3 /// microcosm // F59E12.5a.2 // npl-4.2 /// microcosm // H05C05.1a // H05C05.1 /// microcosm // H06A10.1 // H06A10.1 /// microcosm // H09F14.1 // H09F14.1 /// microcosm // H10E21.5 // H10E21.5 /// microcosm // H12D21.12 // nspa-2 /// microcosm // H20J04.9 // H20J04.9 /// microcosm // H21P03.1 // mbf-1 /// microcosm // H28G03.6 // mtm-5 /// microcosm // K02E10.8 // syg-1 /// microcosm // K02E7.9 // K02E7.9 /// microcosm // K02F2.6 // ser-3 /// microcosm // K03B8.11 // K03B8.11 /// microcosm // K03C7.3 // K03C7.3 /// microcosm // K03E6.1 // lim-6 /// microcosm // K03H1.3 // K03H1.3 /// microcosm // K04F10.4f // bli-4 /// microcosm // K07E12.1a // dig-1 /// microcosm // K07H8.10.1 // K07H8.10 /// microcosm // K07H8.10.2 // K07H8.10 /// microcosm // K07H8.8 // K07H8.8 /// microcosm // K07H8.9 // K07H8.9 /// microcosm // K08A2.5c.2 // nhr-88 /// microcosm // K08B12.5.1 // tag-59 /// microcosm // K08B4.5 // K08B4.5 /// microcosm // K08B4.6 // cpi-1 /// microcosm // K08E3.6.2 // cyk-4 /// microcosm // K08E5.2b.3 // nac-3 /// microcosm // K08F4.3 // K08F4.3 /// microcosm // K09D9.3 // K09D9.3 /// microcosm // K09F6.10 // K09F6.10 /// microcosm // K10B2.1.2 // lin-23 /// microcosm // K10C2.6 // K10C2.6 /// microcosm // K10F12.6 // K10F12.6 /// microcosm // K11D2.1 // K11D2.1 /// microcosm // K11E4.3 // K11E4.3 /// microcosm // K11E4.5b // nhr-71 /// microcosm // K12D12.3 // col-84 /// microcosm // K12D12.4a // K12D12.4 /// microcosm // K12H6.9 // K12H6.9 /// microcosm // M01D1.9 // fbxb-40 /// microcosm // M03F8.1 // M03F8.1 /// microcosm // M05D6.9 // M05D6.9 /// microcosm // PAR2.3a // aak-1 /// microcosm // PAR2.3b.2 // aak-1 /// microcosm // R01H10.5 // R01H10.5 /// microcosm // R05C11.3 // R05C11.3 /// microcosm // R05H11.2 // R05H11.2 /// microcosm // R06C7.2 // R06C7.2 /// microcosm // R06F6.5a.2 // npp-19 /// microcosm // R06F6.5b // npp-19 /// microcosm // R08C7.12.1 // R08C7.12 /// microcosm // R08C7.12.2 // R08C7.12 /// microcosm // R08E5.4 // R08E5.4 /// microcosm // R09B3.1b // exo-3 /// microcosm // R10D12.10 // R10D12.10 /// microcosm // R10E11.1a // cbp-1 /// microcosm // R10E11.1b // cbp-1 /// microcosm // R10E12.2 // R10E12.2 /// microcosm // R10E9.1.1 // msi-1 /// microcosm // R10E9.1.2 // msi-1 /// microcosm // R10F2.4 // R10F2.4 /// microcosm // R11D1.11 // dhs-21 /// microcosm // R11E3.2 // R11E3.2 /// microcosm // R12E2.2.1 // R12E2.2 /// microcosm // R12E2.2.2 // R12E2.2 /// microcosm // R12E2.3.2 // rpn-8 /// microcosm // R13F6.4a // ten-1 /// microcosm // R13H4.1 // nph-4 /// microcosm // R13H8.1e.1 // daf-16 /// microcosm // R148.3a // R148.3 /// microcosm // R151.5b // dpy-31 /// microcosm // R160.5 // R160.5 /// microcosm // R74.3a // xbp-1 /// microcosm // R74.3b.1 // xbp-1 /// microcosm // R74.3b.2 // xbp-1 /// microcosm // T01B7.5b // T01B7.5 /// microcosm // T01E8.3 // plc-3 /// microcosm // T01G6.5 // nhr-211 /// microcosm // T02C1.2 // T02C1.2 /// microcosm // T03D8.4 // grl-14 /// microcosm // T03F1.3 // pgk-1 /// microcosm // T03G11.2 // sru-48 /// microcosm // T04B8.1 // T04B8.1 /// microcosm // T04C12.7 // T04C12.7 /// microcosm // T04F3.2 // T04F3.2 /// microcosm // T04G9.6 // T04G9.6 /// microcosm // T04H1.7 // ugt-55 /// microcosm // T05C1.4a // T05C1.4 /// microcosm // T05C1.4b // T05C1.4 /// microcosm // T05C1.4c // T05C1.4 /// microcosm // T05F1.5 // T05F1.5 /// microcosm // T06E4.5 // T06E4.5 /// microcosm // T06G6.7 // srw-88 /// microcosm // T07C12.11 // T07C12.11 /// microcosm // T07C5.3 // nhr-214 /// microcosm // T07F8.3b.1 // gld-3 /// microcosm // T07G12.4 // T07G12.4 /// microcosm // T07G12.8 // T07G12.8 /// microcosm // T09F5.5 // srh-55 /// microcosm // T10B10.3.2 // T10B10.3 /// microcosm // T10H4.6 // srw-17 /// microcosm // T12F5.4 // lin-59 /// microcosm // T14B1.2 // T14B1.2 /// microcosm // T17H7.4g.1 // gei-16 /// microcosm // T17H7.4k.2 // gei-16 /// microcosm // T18D3.6 // T18D3.6 /// microcosm // T19C3.8 // fem-2 /// microcosm // T19C4.4 // srg-40 /// microcosm // T20B12.1 // T20B12.1 /// microcosm // T21G5.6 // --- /// microcosm // T22A3.3a // lst-1 /// microcosm // T22D1.11 // T22D1.11 /// microcosm // T22F3.6 // srh-212 /// microcosm // T22H2.5a.2 // plsc-2 /// microcosm // T23B12.11 // T23B12.11 /// microcosm // T23F4.4 // nas-27 /// microcosm // T24A11.3 // toh-1 /// microcosm // T24E12.2 // T24E12.2 /// microcosm // T25C12.1a // lin-14 /// microcosm // T26A8.1.1 // T26A8.1 /// microcosm // T26A8.1.3 // T26A8.1 /// microcosm // T26C11.5 // ceh-41 /// microcosm // T26E3.10 // T26E3.10 /// microcosm // T27C5.12 // T27C5.12 /// microcosm // T27E7.1 // T27E7.1 /// microcosm // T28C6.9 // T28C6.9 /// microcosm // T28D6.5a // T28D6.5 /// microcosm // T28D6.5b // T28D6.5 /// microcosm // T28D9.1.2 // T28D9.1 /// microcosm // T28F2.2 // T28F2.2 /// microcosm // T28H10.4 // T28H10.4 /// microcosm // VF11C1L.1 // ppk-3 /// microcosm // W01A8.8 // W01A8.8 /// microcosm // W01C9.4 // W01C9.4 /// microcosm // W02B3.7 // W02B3.7 /// microcosm // W02D7.9 // W02D7.9 /// microcosm // W03B1.8 // W03B1.8 /// microcosm // W03F8.10 // W03F8.10 /// microcosm // W03G11.1b // col-181 /// microcosm // W05G11.5 // W05G11.5 /// microcosm // W07E11.3b // flp-2 /// microcosm // W08E12.7.1 // W08E12.7 /// microcosm // W08F4.3.1 // W08F4.3 /// microcosm // W08F4.3.2 // W08F4.3 /// microcosm // W09B6.2.2 // taf-6.1 /// microcosm // W09D6.4 // W09D6.4 /// microcosm // W10C8.4b // W10C8.4 /// microcosm // Y102A5C.13 // fbxa-112 /// microcosm // Y102A5C.9 // Y102A5C.9 /// microcosm // Y105C5A.23 // Y105C5A.23 /// microcosm // Y105C5B.9 // Y105C5B.9 /// microcosm // Y105E8A.21.2 // Y105E8A.21 /// microcosm // Y108F1.3 // Y108F1.3 /// microcosm // Y110A7A.21 // Y110A7A.21 /// microcosm // Y113G7A.12 // Y113G7A.12 /// microcosm // Y116A8C.29 // Y116A8C.29 /// microcosm // Y116F11B.3.1 // pcp-4 /// microcosm // Y14H12A.1 // Y14H12A.1 /// microcosm // Y19D10A.16 // Y19D10A.16 /// microcosm // Y23H5A.5b // ctn-1 /// microcosm // Y37E3.16.2 // Y37E3.16 /// microcosm // Y38H6A.3 // Y38H6A.3 /// microcosm // Y38H6C.12 // srh-166 /// microcosm // Y39A1A.5 // rabx-5 /// microcosm // Y39A3B.3 // Y39A3B.3 /// microcosm // Y39B6A.14 // pro-3 /// microcosm // Y39B6A.18 // Y39B6A.18 /// microcosm // Y39B6A.30 // Y39B6A.30 /// microcosm // Y39B6A.38 // reps-1 /// microcosm // Y39B6A.46 // Y39B6A.46 /// microcosm // Y39G8B.7 // Y39G8B.7 /// microcosm // Y41G9A.4b // Y41G9A.4 /// microcosm // Y43B11AR.4.1 // rps-4 /// microcosm // Y43F4A.1a // Y43F4A.1 /// microcosm // Y43F8B.3 // Y43F8B.3 /// microcosm // Y43F8C.10 // dmd-3 /// microcosm // Y44A6D.6 // Y44A6D.6 /// microcosm // Y45G12B.2b // Y45G12B.2 /// microcosm // Y45G12C.7 // srd-73 /// microcosm // Y47G6A.20b // rnp-6 /// microcosm // Y47G7B.1 // srh-128 /// microcosm // Y48C3A.3 // Y48C3A.3 /// microcosm // Y48G1BL.5 // Y48G1BL.5 /// microcosm // Y48G1C.11 // Y48G1C.11 /// microcosm // Y48G8AL.10 // Y48G8AL.10 /// microcosm // Y48G8AR.3 // Y48G8AR.3 /// microcosm // Y49E10.20.1 // Y49E10.20 /// microcosm // Y49E10.20.2 // Y49E10.20 /// microcosm // Y51H4A.6 // Y51H4A.6 /// microcosm // Y52B11B.1 // Y52B11B.1 /// microcosm // Y52D5A.1 // Y52D5A.1 /// microcosm // Y53C12A.2.1 // glt-5 /// microcosm // Y53C12B.5b // mab-3 /// microcosm // Y53H1A.2 // Y53H1A.2 /// microcosm // Y54E10A.11 // Y54E10A.11 /// microcosm // Y54G11A.3.1 // Y54G11A.3 /// microcosm // Y54G11A.3.2 // Y54G11A.3 /// microcosm // Y54G2A.48 // Y54G2A.48 /// microcosm // Y54G9A.4 // Y54G9A.4 /// microcosm // Y55F3AM.10 // Y55F3AM.10 /// microcosm // Y55F3C.3 // Y55F3C.3 /// microcosm // Y57G11C.17 // hhat-2 /// microcosm // Y57G11C.48 // Y57G11C.48 /// microcosm // Y64G10A.6 // Y64G10A.6 /// microcosm // Y67A10A.8 // Y67A10A.8 /// microcosm // Y67A6A.1 // Y67A6A.1 /// microcosm // Y67D8C.10a // mca-3 /// microcosm // Y6E2A.9b // Y6E2A.9 /// microcosm // Y71F9AL.2 // Y71F9AL.2 /// microcosm // Y71F9B.8 // Y71F9B.8 /// microcosm // Y74C9A.1 // Y74C9A.1 /// microcosm // Y75B7AL.2 // Y75B7AL.2 /// microcosm // Y76A2A.1 // tag-164 /// microcosm // Y80D3A.9 // Y80D3A.9 /// microcosm // Y82E9BL.18 // Y82E9BL.18 /// microcosm // Y82E9BL.4 // fbxa-25 /// microcosm // Y82E9BR.20 // Y82E9BR.20 /// microcosm // Y94H6A.7 // Y94H6A.7 /// microcosm // Y95B8A.10 // pde-6 /// microcosm // ZC15.1 // ZC15.1 /// microcosm // ZC15.3 // ZC15.3 /// microcosm // ZC168.2 // ZC168.2 /// microcosm // ZC239.8 // sri-51 /// microcosm // ZC317.5 // srg-68 /// microcosm // ZC434.7.2 // ZC434.7 /// microcosm // ZC455.7 // sre-20 /// microcosm // ZC518.1b // ZC518.1 /// microcosm // ZK1025.4a // ZK1025.4 /// microcosm // ZK1053.1 // ZK1053.1 /// microcosm // ZK1086.2 // ZK1086.2 /// microcosm // ZK1225.2 // ZK1225.2 /// microcosm // ZK1240.8 // ZK1240.8 /// microcosm // ZK1321.2c // ZK1321.2 /// microcosm // ZK1321.2f.2 // ZK1321.2 /// microcosm // ZK180.1 // ZK180.1 /// microcosm // ZK270.1 // ptr-23 /// microcosm // ZK370.5.1 // ZK370.5 /// microcosm // ZK430.5 // ZK430.5 /// microcosm // ZK455.7 // pgp-3 /// microcosm // ZK632.3.2 // ZK632.3 /// microcosm // ZK669.7 // ZK669.7 /// microcosm // ZK688.8.2 // gly-3 /// microcosm // ZK792.2.3 // inx-8 /// microcosm // ZK863.8 // ZK863.8 /// microcosm // ZK867.3 // spp-22 /// microcosm // ZK909.6 // ZK909.6 miRNA-4_0 May 13, 2014 miRBase cel-miR-39-3p

Total number of rows: 36353

Table truncated, full table size 99462 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap