GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Platform GPL2004 Query DataSets for GPL2004
Status Public on Apr 28, 2005
Title [Mapping50K_Hind240] Affymetrix Human Mapping 50K Hind240 SNP Array
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Affymetrix
Manufacture protocol see manufacturer's web site
Description Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at

The GeneChip® Mapping 100K Set is the first in a family of products for whole-genome association studies. It is comprised of a set of two arrays that enable genotyping of greater than 100,000 SNPs with a single primer.

copy number analysis
mean marker distance of 26 kb
provides both copy number and allele specific information

Web link
Submission date Apr 28, 2005
Last update date Dec 22, 2017
Organization Affymetrix, Inc.
Phone 888-362-2447
Street address
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
Samples (4330) GSM127606, GSM127607, GSM127608, GSM127609, GSM127610, GSM127611 
Series (56)
GSE5511 Genes regulating B cell development are mutated in acute lymphoid leukaemia
GSE6109 High-resolution Global Genomic Survey of 178 Gliomas
GSE7068 SCLC cell line profiling on 100K arrays

Data table header descriptions
Genome Version
DB SNP Version
Physical Position
ChrX pseudo-autosomal region
Allele A
Allele B
Associated Gene
Genetic Map
Fragment Length Start Stop
Freq Asian
Freq AfAm
Freq Cauc
Het Asian
Het AfAm
Het Cauc
Num chrm Asian
Num chrm AfAm
Num chrm Cauc
SPOT_ID controls

Data table
ID dbSNP RS ID Chromosome Genome Version DB SNP Version Physical Position Strand ChrX pseudo-autosomal region Cytoband SEQUENCE Allele A Allele B Associated Gene Genetic Map Microsatellite Fragment Length Start Stop Freq Asian Freq AfAm Freq Cauc Het Asian Het AfAm Het Cauc Num chrm Asian Num chrm AfAm Num chrm Cauc SPOT_ID
SNP_A-1658633 rs10492973 1 NCBI Build 35, May 2004 123, October 2004 10333251 + FALSE p36.22 taatttggaagacaacaagttcata[C/T]taccagtctgtctgtccccccagtt C T NM_015074 // intron // 0 // Hs.97858 // KIF1B // 23095 // Homo sapiens kinesin family member 1B (KIF1B), transcript variant 1, mRNA. /// AB017133 // intron // 0 // Hs.97858 // KIF1B // 23095 // Homo sapiens KIAA0591/KIF1Bbeta mRNA, complete cds. /// ENST00000263934 // intron // 0 // --- // --- // --- // --- /// ENST00000355249 // intron // 0 // --- // --- // --- // --- /// ENST00000353409 // intron // 0 // --- // --- // --- // --- 16.7521273811523 // D1S450 // D1S2736 // --- // --- /// 20.2290498918198 // D1S1612 // D1S2736 // GGAA3A07 // AFMB049WE9 /// 17.4223142719415 // D1S1612 // D1S2736 // --- // --- D1S2187 // upstream // 42413 /// D1S3552 // downstream // 372222 1090 // 10332641 // 10333730 0.3333 0.3929 0.4167 0.4444 0.477 0.4861 84 84 84
SNP_A-1691633 rs10493003 1 NCBI Build 35, May 2004 123, October 2004 20966703 - FALSE p36.12 aatatgtatctcaaagtttccctaa[G/T]agatacctccagtgattgaattctc G T NM_003760 // intron // 0 // Hs.467084 // EIF4G3 // 8672 // Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), mRNA. /// ENST00000264211 // intron // 0 // --- // --- // --- // --- 39.6229260134725 // D1S2732 // D1S478 // --- // --- /// 47.030834261599 // UNKNOWN // D1S1539 // ATA47D07 // UT5123 /// 41.3033329618964 // --- // --- // 44838 // 548760 D1S1269 // upstream // 69469 /// D1S3535 // downstream // 242717 1825 // 20966529 // 20968353 0 0.0244 0 0 0.0476 0 84 84 84
SNP_A-1669946 rs10492939 1 NCBI Build 35, May 2004 123, October 2004 3326028 - FALSE p36.32 cactttcaatggcttgcacaggcta[C/T]gcgggaatgttccgtgacgtggtct C T NM_199454 // intron // 0 // Hs.99500 // PRDM16 // 63976 // Homo sapiens PR domain containing 16 (PRDM16), transcript variant 2, mRNA. /// NM_022114 // intron // 0 // Hs.99500 // PRDM16 // 63976 // Homo sapiens PR domain containing 16 (PRDM16), transcript variant 1, mRNA. /// ENST00000270722 // intron // 0 // --- // --- // --- // --- 3.68720842286372 // --- // D1S468 // --- // --- /// 3.89000488612123 // --- // D1S468 // --- // AFM280WE5 /// 4.05768907867429 // --- // D1S468 // 42051 // --- D1S3578 // upstream // 101654 /// D1S1448 // downstream // 20026 986 // 3325770 // 3326755 0.3929 0.881 0.6667 0.477 0.2098 0.4444 84 84 84
SNP_A-1691463 rs6704421 1 NCBI Build 35, May 2004 123, October 2004 20965980 - FALSE p36.12 atggtcacattacatgcttattcaa[A/C]gtcagatatctcagattaacaaggc A C NM_003760 // intron // 0 // Hs.467084 // EIF4G3 // 8672 // Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), mRNA. /// ENST00000264211 // intron // 0 // --- // --- // --- // --- 39.6222054880271 // D1S2732 // D1S478 // --- // --- /// 47.0298510389297 // UNKNOWN // D1S1539 // ATA47D07 // UT5123 /// 41.3029089373581 // --- // --- // 44838 // 548760 D1S1269 // upstream // 70192 /// D1S3535 // downstream // 241994 1074 // 20965456 // 20966529 0.2143 0.5595 0.5833 0.3367 0.4929 0.4861 84 84 84
SNP_A-1647681 rs1474868 1 NCBI Build 35, May 2004 123, October 2004 11978430 - FALSE p36.22 ttagtgctcactaactgcaagactc[A/G]acagcgtgtacaccagtagaagctt A G NM_014874 // intron // 0 // Hs.376681 // MFN2 // 9927 // Homo sapiens mitofusin 2 (MFN2), nuclear gene encoding mitochondrial protein, mRNA. /// ENST00000235329 // intron // 0 // --- // --- // --- // --- 21.2928403683867 // D1S2740 // D1S489 // --- // --- /// 25.9464753095119 // D1S2667 // D1S2834 // AFMA224WG9 // AFM321ZB9 /// 25.1518020883554 // D1S2740 // --- // --- // 815107 D1S489 // upstream // 3788 /// D1S1305 // downstream // 91376 651 // 11978405 // 11979055 0.6667 0.7024 0.3333 0.4444 0.4181 0.4444 84 84 84
SNP_A-1691255 rs2275468 1 NCBI Build 35, May 2004 123, October 2004 20965681 + FALSE p36.12 gccttaaatttccaagtaggggcta[G/T]acataatcagcagactggctcacta G T NM_003760 // intron // 0 // Hs.467084 // EIF4G3 // 8672 // Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), mRNA. /// ENST00000264211 // intron // 0 // --- // --- // --- // --- 39.6219075113906 // D1S2732 // D1S478 // --- // --- /// 47.029444422639 // UNKNOWN // D1S1539 // ATA47D07 // UT5123 /// 41.3027335800456 // --- // --- // 44838 // 548760 D1S1269 // upstream // 70491 /// D1S3535 // downstream // 241695 1074 // 20965456 // 20966529 0.7927 0.5833 0.4524 0.3287 0.4861 0.4955 84 84 84
SNP_A-1656886 rs1211531 1 NCBI Build 35, May 2004 123, October 2004 18036201 - FALSE p36.13 tctcaccctccccttggggacctga[A/C]ggcaaaactgggcatgttctcatag A C NM_032880 // upstream // 143345 // Hs.212511 // MGC15730 // 84966 // Homo sapiens hypothetical protein MGC15730 (MGC15730), mRNA. /// ENST00000355895 // upstream // 75600 // --- // --- // --- // --- /// ENST00000251296 // upstream // 143345 // --- // --- // --- // --- 32.6843529083646 // D1S1592 // D1S2826 // --- // --- /// 40.5911647129916 // D1S1592 // D1S2826 // GAAT4D10 // AFM296TE9 /// 35.8282230689657 // D1S1592 // --- // --- // 613868 D1S539 // upstream // 69852 /// D1S1456 // downstream // 39505 1013 // 18036062 // 18037074 0.1429 0.1071 0 0.2449 0.1913 0 84 84 84
SNP_A-1673751 rs3789491 1 NCBI Build 35, May 2004 123, October 2004 6310488 + FALSE p36.31 agagtttcacaaattccaggcagaa[C/T]ggagctgtatgagtctcaaacacaa C T NM_181866 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHd, mRNA. /// NM_181865 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHc, mRNA. /// NM_181864 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHb, mRNA. /// NM_181862 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHa/X, mRNA. /// NM_007274 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHa, mRNA. /// ENST00000344869 // intron // 0 // --- // --- // --- // --- /// ENST00000308067 // intron // 0 // --- // --- // --- // --- /// ENST00000270694 // intron // 0 // --- // --- // --- // --- /// ENST00000262448 // intron // 0 // --- // --- // --- // --- /// ENST00000335808 // intron // 0 // --- // --- // --- // --- 11.4670936774958 // D1S2870 // D1S2642 // --- // --- /// 12.6026476277036 // D1S2633 // D1S214 // AFMA131YA5 // AFM147YF8 /// 12.7821399344363 // D1S2870 // D1S2694 // --- // --- D1S3100 // upstream // 81432 /// D1S1250 // downstream // 2908 1473 // 6310117 // 6311589 0.1071 0.2262 0.0714 0.1913 0.3501 0.1327 84 84 84
SNP_A-1641890 rs10492982 1 NCBI Build 35, May 2004 123, October 2004 14345265 - FALSE p36.21 ttatggttcaaaatcaaattccaat[A/G]atagagaaacacaaataagcaattt A G NM_015866 // downstream // 485390 // Hs.371823 // PRDM2 // 7799 // Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 2, mRNA. /// NM_012231 // downstream // 448384 // Hs.371823 // PRDM2 // 7799 // Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 1, mRNA. /// NM_015866 // downstream // 448384 // Hs.371823 // PRDM2 // 7799 // Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 2, mRNA. /// NM_201628 // upstream // 825566 // Hs.531424 // FLJ43806 // 399563 // Homo sapiens hypothetical protein FLJ43806 (FLJ43806), mRNA. /// NM_182534 // downstream // 842490 // Hs.447976 // FLJ23703 // 200197 // Homo sapiens hypothetical protein FLJ23703 (FLJ23703), mRNA. /// ENST00000311066 // downstream // 485390 // --- // --- // --- // --- /// ENST00000235372 // downstream // 448384 // --- // --- // --- // --- /// ENST00000343137 // downstream // 485390 // --- // --- // --- // --- /// ENST00000251295 // upstream // 325241 // --- // --- // --- // --- /// ENST00000303864 // upstream // 650667 // --- // --- // --- // --- /// ENST00000316575 // downstream // 792170 // --- // --- // --- // --- /// ENST00000338894 // upstream // 825566 // --- // --- // --- // --- /// ENST00000361061 // upstream // 836524 // --- // --- // --- // --- /// ENST00000310916 // downstream // 842490 // --- // --- // --- // --- 25.2214594110819 // D1S2834 // D1S507 // --- // --- /// 31.4738421652478 // D1S2834 // D1S2672 // AFM321ZB9 // AFMA232ZB9 /// 28.0683341060567 // D1S2740 // --- // --- // 815107 D1S1413 // upstream // 121676 /// D1S1418 // downstream // 129457 559 // 14344813 // 14345371 1 0.9024 1 0 0.1761 0 84 84 84
SNP_A-1656716 rs794232 1 NCBI Build 35, May 2004 123, October 2004 18035647 - FALSE p36.13 tgtgcaagggcagatgtgggaagca[C/T]tctttctgacaggcggatgccacac C T NM_032880 // upstream // 143899 // Hs.212511 // MGC15730 // 84966 // Homo sapiens hypothetical protein MGC15730 (MGC15730), mRNA. /// ENST00000355895 // upstream // 75046 // --- // --- // --- // --- /// ENST00000251296 // upstream // 143899 // --- // --- // --- // --- 32.683125907454 // D1S1592 // D1S2826 // --- // --- /// 40.5859991906399 // D1S1592 // D1S2826 // GAAT4D10 // AFM296TE9 /// 35.8259191874035 // D1S1592 // --- // --- // 613868 D1S539 // upstream // 70406 /// D1S1456 // downstream // 38951 871 // 18035065 // 18035935 0.8571 0.881 1 0.2449 0.2098 0 84 84 84
SNP_A-1664559 rs597865 1 NCBI Build 35, May 2004 123, October 2004 17957536 + FALSE p36.13 agacttatcacactgactgtaaata[C/T]gtaagttttctctctagactgtact C T ENST00000359853 // downstream // 7042 // --- // --- // --- // --- /// ENST00000355895 // downstream // 2994 // --- // --- // --- // --- 32.5101254234785 // D1S1592 // D1S2826 // --- // --- /// 39.8576885111875 // D1S1592 // D1S2826 // GAAT4D10 // AFM296TE9 /// 35.5010843630277 // D1S1592 // --- // --- // 613868 D1S1349 // upstream // 17629 /// D1S1358 // downstream // 5398 1455 // 17957017 // 17958471 0.6786 0.7262 0.8452 0.4362 0.3977 0.2616 84 84 84
SNP_A-1747116 rs860379 1 NCBI Build 35, May 2004 123, October 2004 18414756 + FALSE p36.13 cagttctcttgggtatgtatccttg[A/G]agtagaactgctgagtcaaacaatg A G NM_032880 // intron // 0 // Hs.212511 // MGC15730 // 84966 // Homo sapiens hypothetical protein MGC15730 (MGC15730), mRNA. /// ENST00000251296 // intron // 0 // --- // --- // --- // --- 34.0185988429329 // D1S2826 // D1S2644 // --- // --- /// 42.6362023114372 // D1S2826 // D1S2644 // AFM296TE9 // AFMA153XE9 /// 37.4024936191006 // D1S1592 // --- // --- // 613868 D1S1345 // upstream // 1747 /// D1S1312 // downstream // 53787 1170 // 18413635 // 18414804 0.2976 0.4643 0.25 0.4181 0.4974 0.375 84 84 84
SNP_A-1657969 NCBI Build 35, May 2004 123, October 2004 agacactagaaatgacatctacaaa[C/G]gcaaatatgtaattttaacatctga C G 0.2125 0.2073 0.15 0.3347 0.3287 0.255 84 84 84
SNP_A-1716436 rs910232 1 NCBI Build 35, May 2004 123, October 2004 17143820 + FALSE p36.13 caatgagcacctactatgtggccga[A/C]gctcttctaaacgctttacattgaa A C NM_007365 // intron // 0 // Hs.33455 // PADI2 // 11240 // Homo sapiens peptidyl arginine deiminase, type II (PADI2), mRNA. /// ENST00000245530 // intron // 0 // --- // --- // --- // --- 30.9974619681948 // D1S2672 // D1S1592 // --- // --- /// 36.5424772327695 // D1S2672 // D1S3669 // AFMA232ZB9 // GATA29A05 /// 34.1961857890573 // --- // D1S1592 // 15353 // --- D1S2590 // upstream // 16964 /// D1S272E // downstream // 3214 1385 // 17143322 // 17144706 0.3333 0.5 0.6905 0.4444 0.5 0.4274 84 84 84
SNP_A-1664341 rs1280972 1 NCBI Build 35, May 2004 123, October 2004 10912328 - FALSE p36.22 cacagagggttaagagcctgttgtc[C/T]gaagataaacccgctgtgctaaagt C T NM_017766 // upstream // 121355 // Hs.222219 // FLJ20321 // 54897 // Homo sapiens hypothetical protein FLJ20321 (FLJ20321), mRNA. /// NM_173507 // downstream // 29658 // --- // FLJ37118 // 148345 // Homo sapiens hypothetical protein FLJ37118 (FLJ37118), mRNA. /// ENST00000344008 // upstream // 121355 // --- // --- // --- // --- /// ENST00000308835 // downstream // 29658 // --- // --- // --- // --- 18.0748381469989 // D1S2736 // D1S2667 // --- // --- /// 23.278811750506 // D1S2736 // UNKNOWN // AFMB049WE9 // ATA9B08 /// 18.6075108876932 // D1S2736 // --- // --- // 41639 D1S1635 // upstream // 9476 /// D1S1327 // downstream // 127458 1359 // 10911613 // 10912971 0.4167 0.3333 0.369 0.4861 0.4444 0.4657 84 84 84
SNP_A-1715866 rs1832574 1 NCBI Build 35, May 2004 123, October 2004 19894364 + FALSE p36.13 catctctagttttctgtgagcttct[A/G]aaaggtacttctgaaaaaatctggg A G NM_019062 // upstream // 7464 // Hs.124835 // FLJ20225 // 54546 // Homo sapiens hypothetical protein FLJ20225 (FLJ20225), mRNA. /// ENST00000322394 // upstream // 7464 // --- // --- // --- // --- /// ENST00000304491 // upstream // 82326 // --- // --- // --- // --- 37.920829382526 // D1S199 // D1S2732 // --- // --- /// 45.5873565825714 // D1S199 // UNKNOWN // AFM078YG5 // ATA47D07 /// 40.4399054293531 // --- // --- // 64451 // 44838 D1S1402 // upstream // 260496 /// D1S1457 // downstream // 91529 578 // 19893910 // 19894487 0.3929 0.869 0.7857 0.477 0.2276 0.3367 84 84 84
SNP_A-1750090 rs241239 1 NCBI Build 35, May 2004 123, October 2004 4497550 - FALSE p36.32 tttctggctccgaggtaactgcata[C/T]ataattttgttaccaaattcccatg C T NM_018836 // upstream // 127928 // Hs.25924 // SHREW1 // 55966 // Homo sapiens transmembrane protein SHREW1 (SHREW1), mRNA. /// ENST00000356772 // upstream // 534287 // --- // --- // --- // --- /// ENST00000360071 // upstream // 526278 // --- // --- // --- // --- /// ENST00000359090 // upstream // 127928 // --- // --- // --- // --- /// ENST00000354985 // upstream // 127928 // --- // --- // --- // --- 6.41754760607684 // D1S468 // D1S2893 // --- // --- /// 9.21625543684405 // D1S2845 // UNKNOWN // AFM344WE9 // GATA68D01 /// 9.9570708135602 // D1S2845 // D1S2660 // --- // --- D1S2893 // upstream // 4469 /// D1S2845 // downstream // 128776 1241 // 4496588 // 4497828 0 0.0476 0.2738 0 0.0907 0.3977 84 84 84
SNP_A-1655302 rs4920402 1 NCBI Build 35, May 2004 123, October 2004 18034787 + FALSE p36.13 atccccggcttgatcagtatgtgtc[A/G]aacaataacagtaagaactctggta A G NM_032880 // upstream // 144759 // Hs.212511 // MGC15730 // 84966 // Homo sapiens hypothetical protein MGC15730 (MGC15730), mRNA. /// ENST00000355895 // upstream // 74186 // --- // --- // --- // --- /// ENST00000251296 // upstream // 144759 // --- // --- // --- // --- 32.6812211767987 // D1S1592 // D1S2826 // --- // --- /// 40.5779805097328 // D1S1592 // D1S2826 // GAAT4D10 // AFM296TE9 /// 35.8223427647618 // D1S1592 // --- // --- // 613868 D1S539 // upstream // 71266 /// D1S1456 // downstream // 38091 1255 // 18033811 // 18035065 0.1548 0.131 0.3452 0.2616 0.2276 0.4521 84 84 84
SNP_A-1655176 rs794230 1 NCBI Build 35, May 2004 123, October 2004 18034558 - FALSE p36.13 ctccaatctcaagtggcttaaagta[A/G]aagtctatttctctcctgcctaaaa A G NM_032880 // upstream // 144988 // Hs.212511 // MGC15730 // 84966 // Homo sapiens hypothetical protein MGC15730 (MGC15730), mRNA. /// ENST00000355895 // upstream // 73957 // --- // --- // --- // --- /// ENST00000251296 // upstream // 144988 // --- // --- // --- // --- 32.6807139868916 // D1S1592 // D1S2826 // --- // --- /// 40.5758453028401 // D1S1592 // D1S2826 // GAAT4D10 // AFM296TE9 /// 35.8213904382677 // D1S1592 // --- // --- // 613868 D1S539 // upstream // 71495 /// D1S1456 // downstream // 37862 1255 // 18033811 // 18035065 0.1429 0.119 0 0.2449 0.2098 0 84 84 84
SNP_A-1647119 rs10492993 1 NCBI Build 35, May 2004 123, October 2004 18149485 - FALSE p36.13 tgctctgtgccaggcactatgctac[A/G]accttcaatactgcagtctcaaagc A G NM_032880 // upstream // 30061 // Hs.212511 // MGC15730 // 84966 // Homo sapiens hypothetical protein MGC15730 (MGC15730), mRNA. /// ENST00000355895 // upstream // 188884 // --- // --- // --- // --- /// ENST00000251296 // upstream // 30061 // --- // --- // --- // --- 32.9352546613402 // D1S1592 // D1S2826 // --- // --- /// 41.6474301174939 // D1S1592 // D1S2826 // GAAT4D10 // AFM296TE9 /// 36.2993294207547 // D1S1592 // --- // --- // 613868 D1S2826 // upstream // 29053 /// D1S539 // downstream // 43432 607 // 18149082 // 18149688 0.9524 0.6667 1 0.0907 0.4444 0 84 84 84

Total number of rows: 57299

Table truncated, full table size 51539 Kbytes.

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap