NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21145 Query DataSets for GPL21145
Status Public on Nov 16, 2015
Title Infinium MethylationEPIC
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina, Inc.
Manufacture protocol See manufacturer's website
 
 
Submission date Nov 16, 2015
Last update date Jan 20, 2019
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (33134) GSM1942153, GSM1942154, GSM1942155, GSM1942156, GSM1942157, GSM1942158 
Series (558)
GSE75073 Validation of a DNA methylation microarray for 850,000 CpG sites of the human genome enriched in enhancer sequences
GSE81939 Genome-wide DNA methylation profiling in nine HMECs
GSE86831 Critical evaluation of the Illumina MethylationEPIC BeadChip microarray for whole-genome DNA methylation profiling [MethylationEPIC]
Relations
Alternative to GPL23976

Data table header descriptions
ID IlmnID
SPOT_ID
AddressA_ID
AlleleA_ProbeSeq
AddressB_ID
AlleleB_ProbeSeq
Infinium_Design_Type
Next_Base
Color_Channel
Forward_Sequence
Genome_Build
CHR
MAPINFO
SourceSeq

Data table
ID SPOT_ID AddressA_ID AlleleA_ProbeSeq AddressB_ID AlleleB_ProbeSeq Infinium_Design_Type Next_Base Color_Channel Forward_Sequence Genome_Build CHR MAPINFO SourceSeq
cg07881041 cg07881041 0085713262 CTACAAATACAACACCCTCAACCCATATTTCATATATTATCTCATTTAAC II CTGCACGCCTACTGCAGGTGCAGCACCCTCAGCCCATGTTTCATGTATTATCTCATTTAA[CG]CATGTATCATCTCATTTAATGCATGCATTATCTCATTTAATTCTCACAACCCCTCAGGTG 37 19 5236016 TGCAGGTGCAGCACCCTCAGCCCATGTTTCATGTATTATCTCATTTAACG
cg18478105 cg18478105 0046761277 AAATAAATTTCACTCTCAAATCCCAATCTCATACAACAAAACAAAAACCA 0086644198 AAATAAATTTCGCTCTCAAATCCCAATCTCGTACGACGAAACGAAAACCG I C Grn TCCCGTCTTACGGGATGGATTTCGCTCTCAGGTCCCAGTCTCGTGCGGCGGGGCGGGGAC[CG]CAGCCGGCTGGGCGGGGAAGCCCTGAGCCGGGGAAGTCACGTGGGGCGTGTCCGGAGGCG 37 20 61847650 CGGTCCCCGCCCCGCCGCACGAGACTGGGACCTGAGAGCGAAATCCATCC
cg23229610 cg23229610 0021717843 ATAAAATTCTTTCCTTAAAAAACATTAAAACCAAAATAAACAAAAATTCC II GTTTCTGGACAGTAAAATTCTTTCCTTGAAGGACATTAGGGCCAAAATGGGCAAGGATTC[CG]AGATTGGTACATCGAGCGTTATCTTCCAACTCTCTTTTCTAAATGGGCTCATTTAGTAAT 37 1 6841125 CGGAATCCTTGCCCATTTTGGCCCTAATGTCCTTCAAGGAAAGAATTTTA
cg03513874 cg03513874 0029622133 ACAATAAAATAATAAAATCCCATCACTACTTACCCTCCTTAAATAATATC II ATTGTGCCCACCTTGCTGCTGACAGTTAAGCATCACTAAAGTAGGAAATAGGGTCCAAAC[CG]ACACTACTTAAGGAGGGCAAGTAGTGATGGGACCTCATCATCCCATTGCTATCATGGAGC 37 2 198303466 CAATGGGATGATGAGGTCCCATCACTACTTGCCCTCCTTAAGTAGTGTCG
cg09835024 cg09835024 0016745152 AATAAACACCAACCCCAAACCAATCTCACTTTATTAAATTACAAAAATCA 0081631976 AATAAACGCCGACCCCGAACCGATCTCGCTTTATTAAATTACAAAAATCG I A Red AGCCCCGTCATAGGTGGGCGCCGACCCCGAGCCGATCTCGCTTTATTAAATTACAGAAAT[CG]GTATTCAAAAAAAAAAAAAAAAAAGGGCGGGGAGGACACTCCCTCTTCTCTGTTCCCACA 37 X 24072640 GGTGGGCGCCGACCCCGAGCCGATCTCGCTTTATTAAATTACAGAAATCG
cg05451842 cg05451842 0016681196 CRTTCAAATACACTATAACCCRACTAAAAAAACCCCCAACAACCCAAAAC II CACAGCGTGGATGCCCCGATTTCCCAGGTCCCTCCGCAACCCTCAGTAGAACTCCCACCG[CG]CCCTGGGCTGCTGGGGGCCTCCCCAGCCGGGTCACAGTGCACCTGAACGCCCCGGTCCGT 37 14 93581139 CGCCCTGGGCTGCTGGGGGCCTCCCCAGCCGGGTCACAGTGCACCTGAAC
cg14797042 cg14797042 0007767973 TTAACAAAATTCAAACCCCTAATATAAACAAATATAATTCTCACTCTAAC II CCATTCAGGTGAGCAGGGCTGTTGCTCAGCAGGTGAGCCTGCCCCGCCATGGAGACTCAG[CG]CTAGAGTGAGAACCACATCTGCTCACACCAGGGGCCTGAACCCTGCTAACCCCACGGGGG 37 16 57865112 CCCCCGTGGGGTTAGCAGGGTTCAGGCCCCTGGTGTGAGCAGATGTGGTTCTCACTCTAG[CG]CTGAGTCTCCATGGCGGGGCAGGCTCACCTGCTGAGCAACAGCCCTGCTCACCTGAATGG
cg09838562 cg09838562 0025809572 ACTCRAACTATAAAAACTACACTAAAACAACCTTATCTTAAAACRTAAAC II GACTAGTTTAAACTCGGGCTGTAGAAACTGCACTGAGGCAACCTTGTCTTGGAGCGTGGA[CG]CCTTCCCGGGGCACGTCCGTTTCGGATGCAGCCACAAAGCAAATGGGGTAGAACTTGGAC 37 6 15248173 GACTAGTTTAAACTCGGGCTGTAGAAACTGCACTGAGGCAACCTTGTCTTGGAGCGTGGA[CG]CCTTCCCGGGGCACGTCCGTTTCGGATGCAGCCACAAAGCAAATGGGGTAGAACTTGGAC
cg25458538 cg25458538 0051640283 TACTACAACCTCTACAAATTACACACATTATTTAACATCAACCAATTAAC II TCACTCTCGTGTGCTGCAGCCTCTACAAATTGCACACATTGTTTGGCATCAGCCAGTTGG[CG]CTCTTTCTGTCGTACCACCCTCTGGAGCTTCTGTATTTCAAGTTGGCTGCAGAATAAAGC 37 1 144921929 GCTTTATTCTGCAGCCAACTTGAAATACAGAAGCTCCAGAGGGTGGTACGACAGAAAGAG[CG]CCAACTGGCTGATGCCAAACAATGTGTGCAATTTGTAGAGGCTGCAGCACACGAGAGTGA
cg14361672 cg14361672 0051800947 ATCACTACCTAATCTATAACAAACCATTCAACCCATCCTAACATCCTACA 0007743487 ATCACTACCTAATCTATAACGAACCATTCAACCCGTCCTAACATCCTACG I T Red TCACCTTCCCACCTCCTGGAGGACGCTCCTCCACGAAGTGCTGACACAACCTCCTGTAAA[CG]CAGGATGCCAGGACGGGCTGAATGGCCCGCCATAGACTAGGCAGTGACCAGCACACCTCC 37 9 131463936 CGCAGGATGCCAGGACGGGCTGAATGGCCCGCCATAGACTAGGCAGTGAC
cg01763666 cg01763666 0037768834 AAACAAAAATAAACAAACTCAAAATAAAAACAACTAAACTAAAACAAACA 0023754592 GAACAAAAATAAACGAACTCAAAATAAAAACAACTAAACTAAAACAAACG I C Grn CTGGAATGCCAGCTGCTGCTGCTGCTGCAGCTCCTCCACCTTCCTGGCCTCTCTGGCTAG[CG]CCTGCCTCAGCTTAGCTGCCTCTATCTTGAGCTCGCTCACCTCTGCCCGCCTGGCCTCTT 37 17 80159506 CGCCTGCCTCAGCTTAGCTGCCTCTATCTTGAGCTCGCTCACCTCTGCCC
cg09261072 cg09261072 0077677901 AAACRAATATACAAAACACCACTTTAACTCAAACTTCAACTATACCCTAC II TAGATTGACCTGCTAATGAATTGTTTTTGTTTTTACCATCGGATACCAACGTGTTTTTGT[CG]TAGGGTATAGTTGAAGTTTGAGCCAAAGTGGTGCTCTGTATACCCGTCCTCATTTTTCCT 37 15 79170388 AGGAAAAATGAGGACGGGTATACAGAGCACCACTTTGGCTCAAACTTCAACTATACCCTA[CG]ACAAAAACACGTTGGTATCCGATGGTAAAAACAAAAACAATTCATTAGCAGGTCAATCTA
cg02404579 cg02404579 0038605549 CTTACRAAAATTTTACAATTACTATTCCTAACCTATAACRTAACCCCTAC II GATCAGAAAATCTTACGAAGATTTTACAGTTACTGTTCCTAGCCTGTGGCGTGACCCCTG[CG]TGCACCGCCTTTTATTCTGAGGGTTGATCCTCATCTAATCTGAACACTCAGATAGAGGCT 37 16 2526495 AGCCTCTATCTGAGTGTTCAGATTAGATGAGGATCAACCCTCAGAATAAAAGGCGGTGCA[CG]CAGGGGTCACGCCACAGGCTAGGAACAGTAACTGTAAAATCTTCGTAAGATTTTCTGATC
cg12950382 cg12950382 0008726444 ATACCAAAAAATAACAATATACTTATATATATACACATACCCAAATAACA 0076660327 GTACCGAAAAATAACAATATACTTATATATATACACGTACCCGAATAACG I A Red CCCTGCTGCCACCACCTCGGTGCACACACCTACTGGACGCACAGACACACGCATGCCCAC[CG]CCACTCGGGCACGTGCACACACACAAGCACACTGCCACTCTCCGGCACGCGCACACACAA 37 14 105176736 CGCCACTCGGGCACGTGCACACACACAAGCACACTGCCACTCTCCGGCAC
cg02115394 cg02115394 0068602543 AAAATCACTACAACACCTCTAAACATTAACAAAAAAATCAAAAAAACTCA 0059659581 AAAATCGCTACGACGCCTCTAAACATTAACGAAAAAATCAAAAAAACTCG I A Red TTCTGGGGAAAGAAGGCTCAGCAGCCACCTGCTTTTTTGCCCGGGTGGGTGGTCCGGCCC[CG]AGCCCTCCTGACTCTCTCGCCAATGCCCAGAGGCGCCGCAGCGATTCCAGGGAGGCCGCG 37 13 115000168 GGAATCGCTGCGGCGCCTCTGGGCATTGGCGAGAGAGTCAGGAGGGCTCG
cg04118974 cg04118974 0063728202 AACTACCCCACAAAACAATCATAAACAATATATAAATTAATAAACATTCC II CAATGATAATCAACCAATTACTTATATAGCTCTTATAATTGTCAGGCATTGTCCCAAGCA[CG]GAATGTTTATTAACCCATACACTGCTCATGACTGTCCTGTGGGGTAGCTATTAGTATTAT 37 1 110359535 CAATGATAATCAACCAATTACTTATATAGCTCTTATAATTGTCAGGCATTGTCCCAAGCA[CG]GAATGTTTATTAACCCATACACTGCTCATGACTGTCCTGTGGGGTAGCTATTAGTATTAT
cg01236347 cg01236347 0013630234 CAAAATTTCTACTACTACTTCTTCTTTTCTTTTTTTAAAAACAAACTCTC II TGAGGCAGAGGTTGCAGTGAGCCAAGATTGTGTCATTGCACTCCAGCCTGGGCAACAGAG[CG]AGAGTCTGTCTCCAAAAAAAGAAAAGAAGAAGCAGCAGCAGAAACTCTGCCTGATACAGA 37 12 101854174 TCTGTATCAGGCAGAGTTTCTGCTGCTGCTTCTTCTTTTCTTTTTTTGGAGACAGACTCT[CG]CTCTGTTGCCCAGGCTGGAGTGCAATGACACAATCTTGGCTCACTGCAACCTCTGCCTCA
cg22585117 cg22585117 0023618586 TAAATAAACAAACTCTAAAATCAAAATACTTATATTCAAATTCTAACCCC II TTGAAAGTCATGACACAAAGAGGCTATTTTACATGCTCAAGGGTATTGGCTAGTAAATGA[CG]GGGTCAGAATTTGAATACAAGCACTTTGACTTTAGAGCCTGTCCATTCAACAACTACTCA 37 11 124134126 TTGAAAGTCATGACACAAAGAGGCTATTTTACATGCTCAAGGGTATTGGCTAGTAAATGA[CG]GGGTCAGAATTTGAATACAAGCACTTTGACTTTAGAGCCTGTCCATTCAACAACTACTCA
cg25552317 cg25552317 0039755987 CCTAACATTTTAACTTCCACTATTTAAAAATATTACACCTTTCTTTTTTC II AGGCTTACACGCCTGGCATTTTAACTTCCACTGTTTGAAAGTATTACACCTTTCTTTTTT[CG]CACTCCCTCACAGTTCTAAAAAGCTCTGAACTCATTTCGTTCTTCTTTTCTTCCCTTGTC 37 12 92379065 CTGGCATTTTAACTTCCACTGTTTGAAAGTATTACACCTTTCTTTTTTCG
cg23875663 cg23875663 0053703202 AACAAAAACAAACTTCAAAAAAACCTAACAAAACTTTAACATTCATAAAC II TGGCTGGTGTTCTTTCATCTCCACGGGGCATTCCACCCAACAATCACCATCTGCCAGGGA[CG]CCTATGAATGTCAAAGTTCTGCTAGGTTTCTCTGAAGCCTGCTTCTGCTTTCAGCAGCTT 37 20 17299350 CGCCTATGAATGTCAAAGTTCTGCTAGGTTTCTCTGAAGCCTGCTTCTGC

Total number of rows: 868564

Table truncated, full table size 277483 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL21145_MethylationEPIC_15073387_v-1-0.csv.gz 161.2 Mb (ftp)(http) CSV

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap