NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21163 Query DataSets for GPL21163
Status Public on Nov 21, 2015
Title Agilent-074809 SurePrint G3 Mouse GE v2 8x60K Microarray [Probe Name version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Catalog gene expression microarray for Mouse, v2 8x60K

Arrays of this design have barcodes that begin with 16074809 or 2574809.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Probe Name.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

A different version of this platform with the Agilent Feature Number in the ID column is assigned accession number GPL21810.
 
Submission date Nov 20, 2015
Last update date Mar 22, 2017
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (2238) GSM1946443, GSM1946444, GSM1946445, GSM1946446, GSM1946447, GSM1946448 
Series (218)
GSE75233 Targeting Focal Adhesion Kinase Renders Pancreatic Cancers Responsive to Checkpoint Immunotherapy
GSE81153 Fetal and neonatal hematopoietic progenitors are functionally and transcriptionally resistant to Flt3-ITD mutations.
GSE83283 Microarray expression data from WT and Irf4-/- CD4+ T cells after activation

Data table header descriptions
ID Agilent Probe Name
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBank Accession number
LOCUSLINK_ID LocuslinkID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence
SPOT_ID Spot identifier

Data table
ID CONTROL_TYPE REFSEQ GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE SPOT_ID
A_51_P100034 FALSE NM_027162 NM_027162 69674 Mif4gd MIF4G domain containing Mm.390387 ref|NM_027162|ref|NM_001243586|ref|NM_001243587|ref|NM_001243584 chr11:115469328-115469269 mm|11qE2 Mus musculus MIF4G domain containing (Mif4gd), transcript variant 1, mRNA [NM_027162] GO:0003723(RNA binding)|GO:0005634(nucleus)|GO:0005730(nucleolus)|GO:0005737(cytoplasm)|GO:0006417(regulation of translation)|GO:0008022(protein C-terminus binding) GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG
A_51_P100174 FALSE NM_008613 NM_008613 17427 Mns1 meiosis-specific nuclear structural protein 1 Mm.387671 ref|NM_008613|ref|XM_011242665|ref|XM_006510824|gb|D14849 chr9:72306274-72306333 mm|9qD Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA [NM_008613] GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005882(intermediate filament)|GO:0005930(axoneme)|GO:0036126(sperm flagellum)|GO:0042802(identical protein binding)|GO:0051321(meiotic cell cycle)|GO:0070986(left/right axis specification) CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT
A_51_P100208 FALSE NM_177906 NM_177906 330908 Opcml opioid binding protein/cell adhesion molecule-like Mm.379474 ENSMUST00000115243 ref|NM_177906|ens|ENSMUST00000115243|ref|XM_006510437|ref|XM_006510438 chr9:28731887-28731946 mm|9qA4 Mus musculus opioid binding protein/cell adhesion molecule-like (Opcml), mRNA [NM_177906] GO:0003674(molecular_function)|GO:0005886(plasma membrane)|GO:0005911(cell-cell junction)|GO:0008150(biological_process)|GO:0009986(cell surface)|GO:0016337(cell-cell adhesion)|GO:0043005(neuron projection)|GO:0043025(neuronal cell body)|GO:0050767(regulation of neurogenesis)|GO:0070062(extracellular vesicular exosome) TTTGGGTTTTCTTTGGCATAAACCTTATTTCTAGAAATCCTCATGTCCAATTGCTTTCCC
A_51_P100289 FALSE NM_020493 NM_020493 20807 Srf serum response factor Mm.45044 ENSMUST00000015749 ref|NM_020493|ens|ENSMUST00000015749|ref|XM_006523957|ref|XM_011246336 chr17:46683795-46683788 mm|17qC Mus musculus serum response factor (Srf), mRNA [NM_020493] GO:0000790(nuclear chromatin)|GO:0000978(RNA polymerase II core promoter proximal region sequence-specific DNA binding)|GO:0000983(RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity)|GO:0001076(RNA polymerase II transcription factor binding transcription factor activity)|GO:0001077(RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001228(RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001569(patterning of blood vessels)|GO:0001701(in utero embryonic development)|GO:0001707(mesoderm formation)|GO:0001764(neuron migration)|GO:0001829(trophectodermal cell differentiation)|GO:0001947(heart looping)|GO:0002011(morphogenesis of an epithelial sheet)|GO:0002042(cell migration involved in sprouting angiogenesis)|GO:0002521(leukocyte differentiation)|GO:0003257(positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation)|GO:0003677(DNA binding)|GO:0003682(chromatin binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0003705(RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity)|GO:0005515(protein binding)|GO:0005623(cell)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006366(transcription from RNA polymerase II promoter)|GO:0007015(actin filament organization)|GO:0007160(cell-matrix adhesion)|GO:0007275(multicellular organismal development)|GO:0007369(gastrulation)|GO:0007507(heart development)|GO:0007616(long-term memory)|GO:0008134(transcription factor binding)|GO:0008285(negative regulation of cell proliferation)|GO:0008306(associative learning)|GO:0009725(response to hormone stimulus)|GO:0010669(epithelial structure maintenance)|GO:0010735(positive regulation of transcription via serum response element binding)|GO:0010736(serum response element binding)|GO:0016337(cell-cell adhesion)|GO:0021766(hippocampus development)|GO:0022028(tangential migration from the subventricular zone to the olfactory bulb)|GO:0030036(actin cytoskeleton organization)|GO:0030038(contractile actin filament bundle assembly)|GO:0030155(regulation of cell adhesion)|GO:0030168(platelet activation)|GO:0030220(platelet formation)|GO:0030336(negative regulation of cell migration)|GO:0031175(neuron projection development)|GO:0031490(chromatin DNA binding)|GO:0033561(regulation of water loss via skin)|GO:0034097(response to cytokine stimulus)|GO:0035855(megakaryocyte development)|GO:0035912(dorsal aorta morphogenesis)|GO:0042789(mRNA transcription from RNA polymerase II promoter)|GO:0042803(protein homodimerization activity)|GO:0042826(histone deacetylase binding)|GO:0043149(stress fiber assembly)|GO:0043565(sequence-specific DNA binding)|GO:0043589(skin morphogenesis)|GO:0045059(positive thymic T cell selection)|GO:0045214(sarcomere organization) GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT
A_51_P100309 FALSE NM_001039652 NM_001039652 18390 Oprm1 opioid receptor, mu 1 Mm.439715 ref|NM_001039652|ref|NM_001304938|ref|NM_001304937|ref|NM_001302793 chr10:3516213-3516154 mm|10qA1 Mus musculus opioid receptor, mu 1 (Oprm1), transcript variant MOR-1C, mRNA [NM_001039652] GO:0001965(G-protein alpha-subunit binding)|GO:0004871(signal transducer activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004979(beta-endorphin receptor activity)|GO:0004985(opioid receptor activity)|GO:0005245(voltage-gated calcium channel activity)|GO:0005515(protein binding)|GO:0005737(cytoplasm)|GO:0005829(cytosol)|GO:0005886(plasma membrane)|GO:0005887(integral to plasma membrane)|GO:0005925(focal adhesion)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007191(adenylate cyclase-activating dopamine receptor signaling pathway)|GO:0007193(adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway)|GO:0007194(negative regulation of adenylate cyclase activity)|GO:0007200(phospholipase C-activating G-protein coupled receptor signaling pathway)|GO:0007204(elevation of cytosolic calcium ion concentration)|GO:0007218(neuropeptide signaling pathway)|GO:0007268(synaptic transmission)|GO:0007626(locomotory behavior)|GO:0008022(protein C-terminus binding)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0019233(sensory perception of pain)|GO:0019904(protein domain specific binding)|GO:0030425(dendrite)|GO:0030818(negative regulation of cAMP biosynthetic process)|GO:0031005(filamin binding)|GO:0031635(adenylate cyclase-inhibiting opioid receptor signaling pathway)|GO:0031681(G-protein beta-subunit binding)|GO:0032100(positive regulation of appetite)|GO:0032590(dendrite membrane)|GO:0032839(dendrite cytoplasm)|GO:0033554(cellular response to stress)|GO:0038003(opioid receptor signaling pathway)|GO:0038047(morphine receptor activity)|GO:0042383(sarcolemma)|GO:0042755(eating behavior)|GO:0042923(neuropeptide binding)|GO:0043005(neuron projection)|GO:0043204(perikaryon)|GO:0043950(positive regulation of cAMP-mediated signaling)|GO:0043951(negative regulation of cAMP-mediated signaling)|GO:0045019(negative regulation of nitric oxide biosynthetic process)|GO:0045121(membrane raft)|GO:0045429(positive regulation of nitric oxide biosynthetic process)|GO:0045471(response to ethanol)|GO:0048149(behavioral response to ethanol)|GO:0050769(positive regulation of neurogenesis)|GO:0051481(reduction of cytosolic calcium ion concentration)|GO:0051930(regulation of sensory perception of pain)|GO:0060079(regulation of excitatory postsynaptic membrane potential)|GO:0061358(negative regulation of Wnt protein secretion)|GO:0070374(positive regulation of ERK1 and ERK2 cascade)|GO:0070588(calcium ion transmembrane transport)|GO:0071315(cellular response to morphine)|GO:2000310(regulation of N-methyl-D-aspartate selective glutamate receptor activity) GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT
A_51_P100327 FALSE NM_013683 NM_013683 21354 Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Mm.482076 ENSMUST00000166582 ref|NM_013683|ref|NM_001161730|ens|ENSMUST00000166582|ens|ENSMUST00000041633 chr17:34330854-34330913 mm|17qB1 Mus musculus transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (Tap1), transcript variant 1, mRNA [NM_013683] GO:0000166(nucleotide binding)|GO:0002376(immune system process)|GO:0005524(ATP binding)|GO:0005576(extracellular region)|GO:0005739(mitochondrion)|GO:0005783(endoplasmic reticulum)|GO:0006810(transport)|GO:0006952(defense response)|GO:0008152(metabolic process)|GO:0015031(protein transport)|GO:0015197(peptide transporter activity)|GO:0015440(peptide-transporting ATPase activity)|GO:0015833(peptide transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0019060(intracellular transport of viral proteins in host cell)|GO:0019885(antigen processing and presentation of endogenous peptide antigen via MHC class I)|GO:0023029(MHC class Ib protein binding)|GO:0030176(integral to endoplasmic reticulum membrane)|GO:0042270(protection from natural killer cell mediated cytotoxicity)|GO:0042287(MHC protein binding)|GO:0042288(MHC class I protein binding)|GO:0042605(peptide antigen binding)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)|GO:0042803(protein homodimerization activity)|GO:0042825(TAP complex)|GO:0043231(intracellular membrane-bounded organelle)|GO:0043531(ADP binding)|GO:0043657(host cell)|GO:0046967(cytosol to ER transport)|GO:0046978(TAP1 binding)|GO:0046979(TAP2 binding)|GO:0046980(tapasin binding)|GO:0046982(protein heterodimerization activity)|GO:0055085(transmembrane transport) TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG
A_51_P100428 FALSE AK076663 102633419 Gm31251 predicted gene, 31251 Mm.444665 gb|AK076663|riken|4930408C10|nap|NAP088623-1 chr14:55610280-55610339 mm|14qC3 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930408C10 product:myosin heavy chain, cardiac muscle, adult, full insert sequence. [AK076663] AGGAAAATGAAGAAAGGCGATACATGGGCTTTTCCAAATGAGCTTATACATGAATGAAGA
A_51_P100519 FALSE AK016018 75163 4930542C16Rik RIKEN cDNA 4930542C16 gene Mm.491636 gb|AK016018|gb|XR_168524|tc|TC1595163|riken|4930542C16 chr14:25435102-25435043 mm|14qA3 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930542C16 product:hypothetical protein, full insert sequence. [AK016018] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) GCTATCTGTTTTTTCAAACATAGATGTGGAATTAGGAAGTGAGAAAGAAATGGAATCTGG
A_51_P100537 FALSE NM_175020 NM_175020 232717 Prss58 protease, serine 58 Mm.56997 ENSMUST00000063523 ref|NM_175020|ens|ENSMUST00000063523|gb|AK075754|gb|BC048599 chr6:40845394-40845335 mm|6qB1 Mus musculus protease, serine 58 (Prss58), mRNA [NM_175020] GO:0004252(serine-type endopeptidase activity)|GO:0005575(cellular_component)|GO:0005576(extracellular region)|GO:0006508(proteolysis)|GO:0008233(peptidase activity)|GO:0008236(serine-type peptidase activity)|GO:0016787(hydrolase activity) GCCCTGGATTGAAGATACCATGAAAAATAACTGAGCTCCCACAACAGGAGGAATTCTGAA
A_51_P100573 FALSE NM_011947 NM_011947 26406 Map3k3 mitogen-activated protein kinase kinase kinase 3 Mm.27041 ENSMUST00000002044 ref|NM_011947|ens|ENSMUST00000002044|gb|U43187|gb|AK220450 chr11:106015867-106015926 mm|11qE1 Mus musculus mitogen-activated protein kinase kinase kinase 3 (Map3k3), mRNA [NM_011947] GO:0000165(MAPK cascade)|GO:0000166(nucleotide binding)|GO:0000187(activation of MAPK activity)|GO:0001568(blood vessel development)|GO:0004672(protein kinase activity)|GO:0004674(protein serine/threonine kinase activity)|GO:0004708(MAP kinase kinase activity)|GO:0004709(MAP kinase kinase kinase activity)|GO:0005515(protein binding)|GO:0005524(ATP binding)|GO:0005622(intracellular)|GO:0006468(protein phosphorylation)|GO:0016301(kinase activity)|GO:0016310(phosphorylation)|GO:0016740(transferase activity)|GO:0016772(transferase activity, transferring phosphorus-containing groups)|GO:0035556(intracellular signal transduction)|GO:0046777(protein autophosphorylation)|GO:0046872(metal ion binding)|GO:1900745(positive regulation of p38MAPK cascade) CAAGGGTATGAATAGTGTTACTTCATTCAGAGTGTTACTTTGTTTCTCTCCCAATGTTTG
A_51_P100624 FALSE NM_029351 NM_029351 75586 Krtap9-3 keratin associated protein 9-3 Mm.75707 ENSMUST00000062683 ref|NM_029351|ens|ENSMUST00000062683|gb|AK009730|gb|AK131927 chr11:99458872-99458813 mm|11qD Mus musculus keratin associated protein 9-3 (Krtap9-3), mRNA [NM_029351] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0005882(intermediate filament)|GO:0008150(biological_process)|GO:0045095(keratin filament) TGATAACTCAGCTATTGACACGGCTACATAATTTCCCAGGAGGTAAATTCATTTGGGGTG
A_51_P100625 FALSE NM_133996 NM_133996 28194 Apon apolipoprotein N Mm.439846 ENSMUST00000060782 ref|NM_133996|ens|ENSMUST00000060782|gb|AK083289|gb|BC022137 chr10:127692512-127692571 mm|10qD3 Mus musculus apolipoprotein N (Apon), mRNA [NM_133996] GO:0003674(molecular_function)|GO:0005615(extracellular space)|GO:0005737(cytoplasm)|GO:0008150(biological_process) AGCTGAATTCTGGGCCTTGGTTGTATTCATATTGTTTTGGGATATTAAGGAAAGGAAGGT
A_51_P100776 FALSE NM_026450 NM_026450 67911 Zfp169 zinc finger protein 169 Mm.251375 ENSMUST00000110110 ref|NM_026450|ref|NM_001164575|ens|ENSMUST00000110110|ens|ENSMUST00000177530 chr13:48585061-48585002 mm|13qA5 Mus musculus zinc finger protein 169 (Zfp169), transcript variant 1, mRNA [NM_026450] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) GTACTGAGTGTGGTCGAGCCTTTGAGTTTAAGTCTCTTTTCATCAGACACCAAAAGACAC
A_51_P100785 FALSE NM_025507 NM_025507 66354 Snw1 SNW domain containing 1 Mm.271174 ref|NM_025507|gb|AX775977|gb|AK009218|gb|BC049245 chr12:88790936-88790877 mm|12qD2 Mus musculus SNW domain containing 1 (Snw1), mRNA [NM_025507] GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000398(nuclear mRNA splicing, via spliceosome)|GO:0000785(chromatin)|GO:0003713(transcription coactivator activity)|GO:0003714(transcription corepressor activity)|GO:0005112(Notch binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005681(spliceosomal complex)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006397(mRNA processing)|GO:0008024(positive transcription elongation factor complex b)|GO:0008380(RNA splicing)|GO:0016363(nuclear matrix)|GO:0030511(positive regulation of transforming growth factor beta receptor signaling pathway)|GO:0035257(nuclear hormone receptor binding)|GO:0035914(skeletal muscle cell differentiation)|GO:0042771(DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis)|GO:0042809(vitamin D receptor binding)|GO:0042974(retinoic acid receptor binding)|GO:0043923(positive regulation by host of viral transcription)|GO:0045892(negative regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046332(SMAD binding)|GO:0048026(positive regulation of nuclear mRNA splicing, via spliceosome)|GO:0048384(retinoic acid receptor signaling pathway)|GO:0048385(regulation of retinoic acid receptor signaling pathway)|GO:0050769(positive regulation of neurogenesis)|GO:0051571(positive regulation of histone H3-K4 methylation)|GO:0070562(regulation of vitamin D receptor signaling pathway)|GO:0070564(positive regulation of vitamin D receptor signaling pathway)|GO:0071013(catalytic step 2 spliceosome)|GO:0071146(SMAD3-SMAD4 protein complex)|GO:0071300(cellular response to retinoic acid) TTCTCCACCGCGCCATGGGGAACTAAGGTCTTGCTTAGTGCACCTCATTTCAAATAAAAA
A_51_P100787 FALSE NM_025507 NM_025507 66354 Snw1 SNW domain containing 1 Mm.271174 ENSMUST00000021428 ref|NM_025507|ens|ENSMUST00000021428|gb|AX775977|gb|AK009218 chr12:88791047-88790988 mm|12qD2 Mus musculus SNW domain containing 1 (Snw1), mRNA [NM_025507] GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000398(nuclear mRNA splicing, via spliceosome)|GO:0000785(chromatin)|GO:0003713(transcription coactivator activity)|GO:0003714(transcription corepressor activity)|GO:0005112(Notch binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005681(spliceosomal complex)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006397(mRNA processing)|GO:0008024(positive transcription elongation factor complex b)|GO:0008380(RNA splicing)|GO:0016363(nuclear matrix)|GO:0030511(positive regulation of transforming growth factor beta receptor signaling pathway)|GO:0035257(nuclear hormone receptor binding)|GO:0035914(skeletal muscle cell differentiation)|GO:0042771(DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis)|GO:0042809(vitamin D receptor binding)|GO:0042974(retinoic acid receptor binding)|GO:0043923(positive regulation by host of viral transcription)|GO:0045892(negative regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046332(SMAD binding)|GO:0048026(positive regulation of nuclear mRNA splicing, via spliceosome)|GO:0048384(retinoic acid receptor signaling pathway)|GO:0048385(regulation of retinoic acid receptor signaling pathway)|GO:0050769(positive regulation of neurogenesis)|GO:0051571(positive regulation of histone H3-K4 methylation)|GO:0070562(regulation of vitamin D receptor signaling pathway)|GO:0070564(positive regulation of vitamin D receptor signaling pathway)|GO:0071013(catalytic step 2 spliceosome)|GO:0071146(SMAD3-SMAD4 protein complex)|GO:0071300(cellular response to retinoic acid) CTAATCCAGCTGTAACCTTTTCTGTAAACGTTATGAATAACCTCACCTCAAATGGTGAGT
A_51_P100828 FALSE NM_007452 NM_007452 11757 Prdx3 peroxiredoxin 3 Mm.29821 ENSMUST00000025961 ref|NM_007452|ens|ENSMUST00000025961|gb|BD174090|gb|M28723 chr19:60940207-60940148 mm|19qD3 Mus musculus peroxiredoxin 3 (Prdx3), mRNA [NM_007452] GO:0001893(maternal placenta development)|GO:0004601(peroxidase activity)|GO:0005737(cytoplasm)|GO:0005739(mitochondrion)|GO:0005769(early endosome)|GO:0005829(cytosol)|GO:0006915(apoptotic process)|GO:0006979(response to oxidative stress)|GO:0007005(mitochondrion organization)|GO:0008022(protein C-terminus binding)|GO:0008284(positive regulation of cell proliferation)|GO:0008379(thioredoxin peroxidase activity)|GO:0008385(IkappaB kinase complex)|GO:0016209(antioxidant activity)|GO:0016491(oxidoreductase activity)|GO:0018171(peptidyl-cysteine oxidation)|GO:0019900(kinase binding)|GO:0019901(protein kinase binding)|GO:0030099(myeloid cell differentiation)|GO:0032496(response to lipopolysaccharide)|GO:0033673(negative regulation of kinase activity)|GO:0034599(cellular response to oxidative stress)|GO:0034614(cellular response to reactive oxygen species)|GO:0042542(response to hydrogen peroxide)|GO:0042744(hydrogen peroxide catabolic process)|GO:0042802(identical protein binding)|GO:0043027(cysteine-type endopeptidase inhibitor activity involved in apoptotic process)|GO:0043066(negative regulation of apoptotic process)|GO:0043154(negative regulation of cysteine-type endopeptidase activity involved in apoptotic process)|GO:0043209(myelin sheath)|GO:0043524(negative regulation of neuron apoptotic process)|GO:0051092(positive regulation of NF-kappaB transcription factor activity)|GO:0051881(regulation of mitochondrial membrane potential)|GO:0051920(peroxiredoxin activity)|GO:0055114(oxidation-reduction process)|GO:0070062(extracellular vesicular exosome) GCACATAGCACCAGCACTTAATGGAAGCTTCTGATCAAGGTCCTAAAATTTCCTCTTGAA
A_51_P100836 FALSE NM_009702 NM_009702 11834 Aqr aquarius Mm.2545 ENSMUST00000126701 ref|NM_009702|ref|NM_001290788|ens|ENSMUST00000126701|ens|ENSMUST00000125460 chr2:113962656-113960547 mm|2qE4 Mus musculus aquarius (Aqr), transcript variant 1, mRNA [NM_009702] GO:0000398(nuclear mRNA splicing, via spliceosome)|GO:0003723(RNA binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005681(spliceosomal complex)|GO:0006397(mRNA processing)|GO:0008150(biological_process)|GO:0008380(RNA splicing)|GO:0016020(membrane)|GO:0071013(catalytic step 2 spliceosome) ATGTCACCATCAATCTGAATGTCAGAGACCACATCAAGGATGAGTGGGAAGGTCTTCGAA
A_51_P100852 FALSE NM_175449 NM_175449 215900 Fam26f family with sequence similarity 26, member F Mm.34479 ENSMUST00000062784 ref|NM_175449|ens|ENSMUST00000062784|gb|AK153519|gb|AK080048 chr10:33846270-33846211 mm|10qB1 Mus musculus family with sequence similarity 26, member F (Fam26f), mRNA [NM_175449] GO:0003674(molecular_function)|GO:0005261(cation channel activity)|GO:0005575(cellular_component)|GO:0005887(integral to plasma membrane)|GO:0006810(transport)|GO:0006811(ion transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0034220(ion transmembrane transport) TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG
A_51_P100856 FALSE NM_010233 NM_010233 14268 Fn1 fibronectin 1 Mm.193099 ref|NM_010233|ref|NM_001276408|ref|NM_001276409|ref|NM_001276410 chr1:71639659-71637422 mm|1qC3 Mus musculus fibronectin 1 (Fn1), transcript variant 1, mRNA [NM_010233] GO:0001525(angiogenesis)|GO:0001775(cell activation)|GO:0002020(protease binding)|GO:0005178(integrin binding)|GO:0005515(protein binding)|GO:0005576(extracellular region)|GO:0005577(fibrinogen complex)|GO:0005578(proteinaceous extracellular matrix)|GO:0005604(basement membrane)|GO:0005605(basal lamina)|GO:0005615(extracellular space)|GO:0005793(endoplasmic reticulum-Golgi intermediate compartment)|GO:0006953(acute-phase response)|GO:0007044(cell-substrate junction assembly)|GO:0007155(cell adhesion)|GO:0007160(cell-matrix adhesion)|GO:0007161(calcium-independent cell-matrix adhesion)|GO:0008201(heparin binding)|GO:0008347(glial cell migration)|GO:0008360(regulation of cell shape)|GO:0010952(positive regulation of peptidase activity)|GO:0016324(apical plasma membrane)|GO:0016504(peptidase activator activity)|GO:0018149(peptide cross-linking)|GO:0030198(extracellular matrix organization)|GO:0030335(positive regulation of cell migration)|GO:0031012(extracellular matrix)|GO:0033622(integrin activation)|GO:0034446(substrate adhesion-dependent cell spreading)|GO:0035987(endodermal cell differentiation)|GO:0042060(wound healing)|GO:0043066(negative regulation of apoptotic process)|GO:0045340(mercury ion binding)|GO:0045773(positive regulation of axon extension)|GO:0050921(positive regulation of chemotaxis)|GO:0070062(extracellular vesicular exosome)|GO:0071288(cellular response to mercury ion)|GO:0071347(cellular response to interleukin-1)|GO:0072562(blood microparticle) GATGCGATTCATCTAAATGGTGCCATGACAACGGTGTCAACTACAAGATCGGAGAGAAGT
A_51_P100991 FALSE NM_145067 NM_145067 14917 Gucy2c guanylate cyclase 2c Mm.222729 ENSMUST00000032338 ref|NM_145067|ref|NM_001127318|ens|ENSMUST00000032338|ens|ENSMUST00000078095 chr6:136648027-136646532 mm|6qG1 Mus musculus guanylate cyclase 2c (Gucy2c), transcript variant 2, mRNA [NM_145067] GO:0000166(nucleotide binding)|GO:0004383(guanylate cyclase activity)|GO:0004672(protein kinase activity)|GO:0005524(ATP binding)|GO:0005525(GTP binding)|GO:0005783(endoplasmic reticulum)|GO:0005886(plasma membrane)|GO:0006182(cGMP biosynthetic process)|GO:0006468(protein phosphorylation)|GO:0009190(cyclic nucleotide biosynthetic process)|GO:0009636(response to toxin)|GO:0015643(toxin binding)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016772(transferase activity, transferring phosphorus-containing groups)|GO:0016829(lyase activity)|GO:0016849(phosphorus-oxygen lyase activity)|GO:0035556(intracellular signal transduction)|GO:0042127(regulation of cell proliferation) AAGAATACAACCTGCCATCCCCACCGACAGTGGAGAACCAACAGCGCCTGCAGACTGAGT

Total number of rows: 56745

Table truncated, full table size 40952 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL21163_074809_D_GEO_20150624.txt.gz 11.4 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap