NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4080 Query DataSets for GPL4080
Status Public on Aug 18, 2006
Title OSUGW_MG_21K_vA.7.1.1
Technology type in situ oligonucleotide
Distribution commercial
Organism Pyricularia grisea
Manufacturer Agilent
Manufacture protocol http://www.chem.agilent.com/scripts
Catalog number G4137A
Support glass
Coating unknown
 
Description http://www.chem.agilent.com/scripts
 
Web link http://www.chem.agilent.com/scripts
Contributor(s) Raghupathy MB, Wang G, Couglan S
Submission date Aug 10, 2006
Last update date Aug 18, 2006
Contact name Mohan B Raghupathy
E-mail(s) mohanbabu_r@yahoo.com, wang.620@osu.edu
Phone 614 292 9280
Fax 614 292 4455
URL http://plantpath.osu.edu/~wang/index.php
Organization name The Ohio State University
Department Department of Plant Pathology
Lab Plant disease resistance and fucntional genomics
Street address 201 Kottman Hall, 2021 Coffey Rd
City Columbus
State/province OH
ZIP/Postal code 43210
Country USA
 
Samples (1) GSM126989
Series (1)
GSE5518 Differential gene expression of Appresorium vs Vegetative mycelium of Magnaporthe using oligoarray

Data table header descriptions
ID
Probe_Name
SEQUENCE
TargetID
Gene_Name
Gene_Description
GI_
SPOT_ID

Data table
ID Probe_Name SEQUENCE TargetID Gene_Name Gene_Description GI_ SPOT_ID
3 A_98_P16572 ATGGCGCCAATGTTGCCTTTTCATTGGGAAGTGCCGCGAGGAATGGTGCCATTACTGTTA A_98_T18916 MERG4_G.8567.MERG4_T.SMPLMG_T.ctg-307.3.ctg-307.9868 (MG01655.1) hypothetical protein AZM12100
4 A_97_P22453 TGCCAAGCAAGCATGTGTTCGTCCTGGTTCCTTTCGGTAATGAAAAATTAAGTGCGGCTT A_97_T14996 OSJNEd09C24.r Putative EREBP-like protein [Oryza sativa] gi|15217288|gb|AAK92632.1|AC079633_12 AZR00644
5 A_98_P9481 TAACATCTCCAAGGGAGCAACAATATTCCTTTGCCCCGACGAGGATGTCGCGGGGCAGAT A_98_T11705 MERG4_G.1360.MERG4_T.SMPL_T.ctg-120.6.ctg-120.12365 (MG00649.1) predicted protein AZM03974
6 A_98_P13197 CTATTCCCTGCGGCTTTACGAGCGCGAGGCGTTAGTTTGGAAATGCTGGAGCTGGTGTGA A_98_T15475 MERG4_G.5126.MERG4_T.SMPL_T.ctg-1731.3.ctg-1731.8007 (MG09107.1) predicted protein AZM08351
8 A_98_P19012 TCCCCTCGCCCGAGACGTACAACCCGCGCCGCTTCCTGGACCTGCGCTCCCGCCCCGGCC A_98_T21384 MERG4_G.11036.MERG4_T.SMPL_T.ctg-676.2.ctg-676.3908 putative monooxygenase [Streptomyces coelicolor A3(2)] emb|CAB55657.1| AZM01146
9 A_98_P11216 TGATAGCGATAGTGAGGACGAGGAAGACCAGCTCCGTAGGCAGGTTGCTCAGACCAACCA A_98_T13461 MERG4_G.3111.MERG4_T.SMPLMG_T.ctg-1431.1.ctg-1431.83 (MG09747.1) predicted protein AZM06150
10 A_98_P10312 ACCAGACCTCCTCTCACAACTCGTATCATTACCAGAATGGCTACGGATCAAACTCCAACG A_98_T12544 MERG4_G.2190.MERG4_T.SMPL_T.ctg-1309.1.ctg-1309.2189 predicted protein AZM05140
11 A_97_P24034 TCTGAATTCACTGACCAAGAGACCTAAACATTTTCTGGAGAACACATGCTGATGCTGTGG A_97_T12383 OSIIEb12I06.r EST AZR02225
12 A_98_P18028 AAGAAGAAGAGCACGCAAAGATTGAACAGATGAGGAGAGAGGCTGGATTACCTCCTACTA A_98_T20392 MERG4_G.10058.MERG4_T.WHIV2_T.MG02714.1.ctg-557.32543 (MG02714.1) hypothetical protein AZM00067
13 A_98_P16962 GCTGCGCCGCCAAGTTCACCGACGTTCAGCTCAAGATCTCGGAGATTATGCAAGCAGAGA A_98_T19311 MERG4_G.8972.MERG4_T.WHIV2_T.MG00162.1.ctg-37.28857 (MG00162.1) predicted protein AZM12543
15 A_97_P27252 CATAGCTAGCAATGTGCATTTTAACTGTATTTGTAGCGGTTGTAAAATTGTGTGCCTTTA A_97_T10725 Contig1726 B1099D03.22 [Oryza sativa (japonica cultivar-group)] gi|20804968|dbj|BAB92645.1| AZR05443
16 A_98_P18039 AGTACCCGGCAGTAGTGGTCACTCTTGGTGGATTCTGGGAACGTCCAACGAGACAAGGGA A_98_T20403 MERG4_G.10048.MERG4_T.SMPLMG_T.ctg-557.6.ctg-557.9973 predicted protein AZM00056
17 A_97_P22365 AGACGTTATGTCGTATCTTTGGCGCGAGAGGGAATAAAATCCAGTGAAGTCTGTGGTTCA A_97_T15754 OSJNEd14F10.r putative acetyl transferase [Oryza sativa (japonica cultivar-group)] gi|11034585|dbj|BAB17109.1| AZR00556
18 A_98_P14087 GTATCGGGCGTCAGCGGCTTTAAACAGGGATGCAACGGCCACACCTCGACTCCGCTTTGA A_98_T16379 MERG4_G.6027.MERG4_T.SMPL_T.ctg-1871.1.ctg-1871.487 predicted protein AZM09336
19 A_97_P27657 GTGGGAGATGTGTTTGTCATTTAATGATCCGACAATAATTGAAGTGAATTCCGTATCTTT A_97_T12484 OSIIEb13F15.r Unknown protein [Oryza sativa] gi|17047033|gb|AAL34938.1|AC079037_11 AZR05848
20 A_98_P20477 CGCCAGCTGGCGCATCATCTCCTCGATCGAGCAGAAGGAGGAGTCCAAGGGCTCAGACAA A_98_T22863 MERG4_G.12519.MERG4_T.SMPLMG_T.ctg-853.10.ctg-853.22024 predicted protein AZM02778
22 A_98_P12516 GGAGCAACAATCAGCATTGCATTTCAAATCGATGAAAGTTTGCGATAATTGCAGCGTTCG A_98_T14785 MERG4_G.4435.MERG4_T.WHIV2_T.MG08666.1.ctg-1636.1357 (MG08666.1) predicted protein AZM07594
23 A_97_P26661 TGGCAAGAGTGTGTATCCGCTCATACTGAAGGATCTTTAAAAAGATCATTAGGGCTTTCG A_97_T15525 OSJNEd12K13.r transposase [Bacillus cereus] gi|20142126|dbj|BAB88926.1| AZR04852
24 A_97_P27734 TGGCATATATGAGCTGACAGAAATATATTGAATTGACACTTTGTGAACCTTGAATTGAGG A_97_T11057 OSIIEb02I23.r putative Ser/Thr protein kinase; protein id: At1g04700.1 [Arabidopsis thaliana] gi|15219796|ref|NP_171964.1| AZR05925
25 A_98_P20424 CCCGCCAAGAAGTTGCGCGAGAGTCCTCAGGAGTCCGGTAAAGACTCGGAGGATGGGGAA A_98_T22809 MERG4_G.12467.MERG4_T.SMPL_T.ctg-848.10.ctg-848.24594 (MG04520.1) predicted protein AZM02721

Total number of rows: 20579

Table truncated, full table size 3920 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap