GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Platform GPL4134 Query DataSets for GPL4134
Status Public on Aug 17, 2006
Title Agilent-014868 Whole Mouse Genome Microarray 4x44K G4122F (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at
Catalog number G4122F
Designed to truly represent all known genes in the mouse genome and their resulting transcripts, Agilent's Whole Mouse Genome Oligo – 4X44K microarray is comprised of 41,534 60-mer oligonucleotide probes representing over 41,000 mouse genes and transcripts. Content for this microarray was generated from leading public databases, including RefSeq, RIKEN, NIA, Ensembl, RIKEN, UCSC Goldenpath, and Unigene.

Arrays of this design have barcodes that begin with 16014868 or 2514868.

Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL7202.
Submission date Aug 17, 2006
Last update date May 10, 2018
Organization Agilent Technologies
Phone 877-424-4536
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
Samples (7380) GSM189373, GSM189663, GSM189664, GSM189665, GSM189666, GSM189667 
Series (592)
GSE7800 Identification of genes enriched in putative stem/progenitor cells from mouse embryonic pancreas
GSE7815 Histone H3K4 and H3K27 trimethylation analysis in ES cells, Mefs and induced pluriptent cells.
GSE7866 Gene expression comparison of mouse ES cells and EpiSCs
Alternative to GPL7202

Data table header descriptions
ID Agilent feature number
COL Column
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
GENE Entrez Gene ID

Data table
1 266 170 GE_BrightCorner GE_BrightCorner pos
2 266 168 DarkCorner DarkCorner pos
3 266 166 DarkCorner DarkCorner pos
4 266 164 DarkCorner DarkCorner pos
5 266 162 DarkCorner DarkCorner pos
6 266 160 DarkCorner DarkCorner pos
7 266 158 DarkCorner DarkCorner pos
8 266 156 DarkCorner DarkCorner pos
9 266 154 DarkCorner DarkCorner pos
10 266 152 DarkCorner DarkCorner pos
11 266 150 DarkCorner DarkCorner pos
12 266 148 NM_009912 A_52_P616356 FALSE NM_009912 NM_009912 12768 Ccr1 chemokine (C-C motif) receptor 1 Mm.274927 ENSMUST00000026911 NP813468 ref|NM_009912|gb|AK076275|gb|AK031109|ens|ENSMUST00000026911 chr9:123681918-123681859 mm|9qF4 Mus musculus chemokine (C-C motif) receptor 1 (Ccr1), mRNA [NM_009912] GO:0001584(rhodopsin-like receptor activity)|GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004983(neuropeptide Y receptor activity)|GO:0005515(protein binding)|GO:0006954(inflammatory response)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor protein signaling pathway)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016493(C-C chemokine receptor activity)|GO:0030099(myeloid cell differentiation)|GO:0030595(immune cell chemotaxis)|GO:0045028(purinergic nucleotide receptor activity, G-protein coupled) AGTATAAGATGTTATGTCAAAAAATTAAATCTGTAACAAACTAAAGTTTTTCTATCCAAT
13 266 146 NM_008725 A_52_P580582 FALSE NM_008725 NM_008725 230899 Nppa natriuretic peptide precursor type A Mm.19961 TC1481091 ref|NM_008725|gb|AK147180|gb|BC089615|riken|I920194N08 chr4:146991457-146991516 mm|4qE2 Mus musculus natriuretic peptide precursor type A (Nppa), mRNA [NM_008725] GO:0005179(hormone activity)|GO:0005576(extracellular region)|GO:0005737(cytoplasm)|GO:0007582(physiological process)|GO:0050880(regulation of blood vessel size) CTTCCTGCCTTCATCTATCACGATCGATGTTAAATGTAGATGAGTGGTCTAGTGGGGTCT
14 266 144 NM_007473 A_52_P403405 FALSE NM_007473 NM_007473 11832 Aqp7 aquaporin 7 Mm.8728 ENSMUST00000030136 NP816185 ref|NM_007473|gb|AK131744|gb|AK076642|ens|ENSMUST00000030136 chr4:41172732-41172673 mm|4qA5 Mus musculus aquaporin 7 (Aqp7), mRNA [NM_007473] GO:0005215(transporter activity)|GO:0005887(integral to plasma membrane)|GO:0006810(transport)|GO:0006833(water transport)|GO:0015250(water channel activity)|GO:0015288(porin activity)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0019867(outer membrane) TCTGTGCCTCTAGAGCACTTCTAAGTAGAGCTTCTCTTTGACCACAACCGTACTGCAATA
15 266 142 AK046412 A_52_P819156 FALSE AK046412 ENSMUST00000094955 NP577252 gb|AK046412|ens|ENSMUST00000094955|riken|B230380O10|tc|NP577252 chr4:98688985-98689044 mm|4qC6 Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230380O10 product:hypothetical protein, full insert sequence. [AK046412] AACTAAACTTTACGGTGACCCTCTATTTTTATTATGCCACATGTATTTTAAGAGAGGTGG
16 266 140 NM_028752 A_51_P331831 FALSE NM_028752 NM_028752 74096 Hvcn1 hydrogen voltage-gated channel 1 Mm.28804 ENSMUST00000100747 NP427055 ref|NM_028752|ref|NM_001042489|gb|AK154880|ens|ENSMUST00000100747 chr5:121476234-121476293 mm|5qF Mus musculus hydrogen voltage-gated channel 1 (Hvcn1), transcript variant 2, mRNA [NM_028752] GO:0005216(ion channel activity)|GO:0006810(transport)|GO:0006811(ion transport)|GO:0016021(integral to membrane) TCAGTGCTCACAAATAAAACCTGTCAGGCTTTTCCTCTAAGTACAAGTTAAAGAATTATC
17 266 138 NA NA ignore
18 266 136 NM_008159 A_51_P430630 FALSE NM_008159 NM_008159 14762 Gpr33 G protein-coupled receptor 33 Mm.12890 ENSMUST00000040161 NP048179 ref|NM_008159|gb|AF045766|gb|BC064084|ens|ENSMUST00000040161 chr12:50036303-50036244 mm|12qB3 Mus musculus G protein-coupled receptor 33 (Gpr33), mRNA [NM_008159] GO:0001584(rhodopsin-like receptor activity)|GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004982(N-formyl peptide receptor activity)|GO:0005887(integral to plasma membrane)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor protein signaling pathway)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0045028(purinergic nucleotide receptor activity, G-protein coupled) CTCACTAAGAGTCAGCCATTACCTTTACACTTGACACTGGGACTTGCAGTGGTGACTATT
19 266 134 AK084122 A_52_P502357 FALSE AK084122 320122 C230086J09Rik RIKEN cDNA C230086J09 gene Mm.37126 TC1522326 gb|AK084122|gb|AK048966|riken|D130096I20|riken|C230086J09 chr14:88145282-88145223 mm|14qE2.1 Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130096I20 product:unclassifiable, full insert sequence. [AK084122] CTCACTAGTGAAGACACCATAGAGTATGAAACTTATTGTAACTCTTTTTAAGTCAGTGTC
20 266 132 XM_486185 A_52_P299964 FALSE XM_486185 XM_486185 270118 Maml2 mastermind like 2 (Drosophila) Mm.116898 ENSMUST00000034401 NP515033 gb|XM_486185|gb|BC053388|ens|ENSMUST00000034401|ref|XM_972692 chr9:13457783-13457842 mm|9qA1 PREDICTED: Mus musculus mastermind like 2 (Drosophila) (Maml2), mRNA [XM_486185] GO:0003713(transcription coactivator activity)|GO:0005634(nucleus)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter) CATGGCAATACCAAGCCTTTGTTCCATTTTAACTCAGACCAAGCAAACCAGCAGATGCCT

Total number of rows: 45220

Table truncated, full table size 23041 Kbytes.

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL4134_old_annotations.txt.gz 6.6 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap