NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4135 Query DataSets for GPL4135
Status Public on Aug 17, 2006
Title Agilent-014879 Whole Rat Genome Microarray 4x44K G4131F (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Rattus norvegicus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4131F
 
Description
With a focus on well known rat genes and homologues to human and mouse genes with useful annotation, Agilent's Whole Rat Genome Oligo – 4X44K microarray provides researchers with a new tool for modeling human biology in the rat model organism. For researchers, this means they now have access to a microarray made up of relevant content that has been empirically validated by Agilent.

Arrays of this design have barcodes that begin with 16014879 or 2514879.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL7294.
 
Submission date Aug 17, 2006
Last update date Dec 21, 2016
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (2040) GSM253585, GSM253586, GSM253587, GSM253588, GSM253589, GSM253590 
Series (86)
GSE10034 Transcriptomic Analysis of Nephrotoxicity Induced by Cephaloridine, a Representative Cephalosporin Antibiotic
GSE10148 Analysis of Endoglin function in rat hepatic stellate cells (HSC)
GSE11022 Dietary calcium inhibits colitis development in HLA-B27 transgenic rats
Relations
Alternative to GPL7294

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 266 170 GE_BrightCorner GE_BrightCorner pos
2 266 168 DarkCorner DarkCorner pos
3 266 166 DarkCorner DarkCorner pos
4 266 164 DarkCorner DarkCorner pos
5 266 162 DarkCorner DarkCorner pos
6 266 160 DarkCorner DarkCorner pos
7 266 158 DarkCorner DarkCorner pos
8 266 156 DarkCorner DarkCorner pos
9 266 154 DarkCorner DarkCorner pos
10 266 152 DarkCorner DarkCorner pos
11 266 150 DarkCorner DarkCorner pos
12 266 148 AA892298 A_44_P465448 FALSE AA892298 Rn.14747 gb|AA892298 chr9:57247899-57249303 rn|9q31 AA892298 EST196101 Normalized rat kidney, Bento Soares Rattus sp. cDNA clone RKIAO74 3' end, mRNA sequence [AA892298] CCACATCTGTATGCAGTGTCACAGACATTCTCCTTCTTGATGCTTCTAGGGAGCACTATT
13 266 146 AI232741 A_44_P514796 FALSE AI232741 Rn.12611 gb|AI232741|gb|AW254068|gb|BI278122 chr7:122235251-122235192 rn|7q34 AI232741 EST229429 Normalized rat kidney, Bento Soares Rattus sp. cDNA clone RKICF89 3' end, mRNA sequence [AI232741] GTTTAAAATTTATTGACGTGATTTCCCATAAGGATGACGGCCCAGAAGCACTCAGCTGTG
14 266 144 NM_057188 A_44_P409518 FALSE NM_057188 NM_057188 117533 Gmpr guanosine monophosphate reductase Rn.3862 ENSRNOT00000023613 TC568850 ref|NM_057188|gb|AF090867|ens|ENSRNOT00000023613|tc|TC568850 chr17:25153992-25153933 rn|17p13 Rattus norvegicus guanosine monophosphate reductase (Gmpr), mRNA [NM_057188] GO:0003824(catalytic activity)|GO:0003920(GMP reductase activity)|GO:0009409(response to cold)|GO:0016491(oxidoreductase activity)|GO:0030955(potassium ion binding)|GO:0046872(metal ion binding) GCAGAAGCTGAAGCTTTTCTACGGCATGAGCTCAGACACAGCCATGAAGAAACACGCGGG
15 266 142 XM_236342 A_44_P279262 FALSE XM_236342 Rn.21843 ENSRNOT00000049602 gb|XM_236342|ens|ENSRNOT00000049602 chr8:69116608-69116667 rn|8q24 Rattus norvegicus similar to CRAG protein (4C711) (LOC315756), mRNA [XM_236342] TTGGGTTTAACGTCTCTGGTAGATGGAAAGTCTGATGGTTCTAGAACGATTCACACTAAC
16 266 140 NM_001014243 A_44_P375042 FALSE NM_001014243 NM_001014243 365215 RGD1309888 similar to RIKEN cDNA 1500002O20 Rn.32677 ENSRNOT00000026669 TC521750 ref|NM_001014243|gb|XM_344869|gb|BC087051|ens|ENSRNOT00000026669 chr1:79742705-79743531 rn|1q21 Rattus norvegicus similar to RIKEN cDNA 1500002O20 (RGD1309888), mRNA [NM_001014243] CCACAGCTGTCGCACACAATCCTCACGGAGAAGAACTGGTTCCACTATGCTGCCAGAATC
17 266 138 XM_222163 A_44_P269499 FALSE XM_222163 Rn.154560 ENSRNOT00000011278 gb|XM_222163|gb|XR_009247|ens|ENSRNOT00000011278 chr12:30395960-30395901 rn|12q14 Rattus norvegicus similar to 17,000 dalton myosin light chain (LOC304447), mRNA [XM_222163] TGAAATCCGTCATATCCTAGTCACGCTGGGCGAGAATATGACAGAGGAAGAAGTAGAGAT
18 266 136 AA891661 A_44_P204808 FALSE AA891661 Rn.1618 gb|AA891661 chr4:84396575-84396516 rn|4q24 AA891661 EST195464 Normalized rat kidney, Bento Soares Rattus sp. cDNA clone RKIAF23 3' end, mRNA sequence [AA891661] TATTCTGCTGCTTCTAAGCACCTGAAGAATGTGGCTCTCGGTTCACGACATGGTTAACGG
19 266 134 NM_033350 A_44_P438090 FALSE NM_033350 NM_033350 29322 Plcb3 phospholipase C, beta 3 Rn.16983 ENSRNOT00000028720 TC538381 ref|NM_033350|gb|XM_342005|gb|M99567|ens|ENSRNOT00000028720 chr1:209787835-209787776 rn|1q43 Rattus norvegicus phospholipase C, beta 3 (Plcb3), mRNA [NM_033350] GO:0004629(phospholipase C activity)|GO:0004871(signal transducer activity)|GO:0007242(intracellular signaling cascade)|GO:0016042(lipid catabolism)|GO:0016787(hydrolase activity) GGCTCAGGGAGGTTGTCCTGGACGCACATACGACTCAGTTCAAGAGGCTGAAGGAGTTGA
20 266 132 XM_214021 A_44_P330643 FALSE XM_214021 XM_214021 289561 Polr2b_predicted polymerase (RNA) II (DNA directed) polypeptide B (predicted) Rn.153952 ENSRNOT00000039252 TC535070 ref|XM_214021|ref|XM_001075841|gb|CB546931|ens|ENSRNOT00000039252 chr14:33077593-33077330 rn|14p11 PREDICTED: Rattus norvegicus polymerase (RNA) II (DNA directed) polypeptide B (predicted) (Polr2b_predicted), mRNA [XM_214021] GO:0003677(DNA binding)|GO:0005665(DNA-directed RNA polymerase II, core complex)|GO:0006366(transcription from RNA polymerase II promoter) AGAGGACATGCCGTTCACTTGTGAAGGCATAACTCCTGACATCATCATAAACCCCCACGC

Total number of rows: 45220

Table truncated, full table size 19079 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL4135_old_annotations.txt.gz 5.7 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap