NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4225 Query DataSets for GPL4225
Status Public on Nov 19, 2007
Title Drosophila microarray sheet
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Drosophila melanogaster
Manufacturer Laboratory of Experimantal Gerontology, National Institute on Aging
Manufacture protocol PCR products of 14,151 predicted or known genes in D. melanogaster were used to generate DNA microarray. The length of each PCR amplicon was 100-600 bp. cDNA was amplified with universal primers (AATGCAGGTTAACCTGGCTTATCG and AACGCGGCTACAATTAATACATAACC). PCR products were printed on 3-D slides (Full Moon Biosystems Inc.).
 
 
Contributor(s) Yamaza H, Zhan M, Sun Y, Sinclair J, Li H, Zou S
Submission date Aug 25, 2006
Last update date Nov 19, 2007
Contact name Haruyoshi Yamaza
E-mail(s) yamazah@grc.nia.nih.gov
Phone 410-558-8450
Fax 410-558-8302
Organization name National Institute on Aging
Department Laboratory of Experimental Gerontology
Street address 6200 Seaforth Street
City Baltimore
State/province MD
ZIP/Postal code 21224
Country USA
 
Samples (70) GSM132264, GSM132265, GSM132266, GSM132267, GSM132268, GSM132269 
Series (1)
GSE6314 Temporal and Spatial Transcriptional Profiles of Aging in Drosophila

Data table header descriptions
ID
Block the block number of the feature
Column the column number of the feature
Row the row number of the feature
Name the name of the feature derived from the Array List
ORF gene symbol of the feature derived from the Array List
SPOT_ID spot identifier

Data table
ID Block Column Row Name ORF SPOT_ID
1 1 1 1 CT30019 CG10711
2 1 2 1 CT32994 CG13609
3 1 3 1 CT17698 CG5597
4 1 4 1 CT22043 CG7135
5 1 5 1 CT21320 CG6884
6 1 6 1 CT13308 CG12234
7 1 7 1 CT4012 CG1553
8 1 8 1 CT21344 CG6890
9 1 9 1 CT38731 CG17514
10 1 10 1 CT14074 CG4297
11 1 11 1 CT21370 CG6905
12 1 12 1 CT4054 CG3099
13 1 13 1 CT17720 CG9575
14 1 14 1 CT20678 CG6649
15 1 15 1 CT17736 CG5627
16 1 16 1 CT17772 CG5695
17 1 17 1 CT7740 CG12132
18 1 18 1 CT35117 CG12622
19 1 19 1 CT33707 CG14112
20 1 20 1 CT26421 CG9269

Total number of rows: 17664

Table truncated, full table size 524 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap