NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6097 Query DataSets for GPL6097
Status Public on Dec 13, 2007
Title Illumina human-6 v1.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The Human-6 Expression BeadChip contains six arrays on a single BeadChip, each with >46,000 probes derived from human genes in the National Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) and UniGene databases.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://0-www.ncbi.nlm.nih.gov.brum.beds.ac.uk/projects/geo/info/spreadsheet.html.
 
Submission date Nov 08, 2007
Last update date Jan 18, 2013
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (178) GSM257770, GSM257793, GSM257794, GSM257795, GSM257796, GSM257797 
Series (12)
GSE10213 Performance comparison of Affymetrix and Illumina microarray technologies_IlluminaDataSet
GSE10431 The tumor suppressor Semaphorin 3B triggers a pro-metastatic program mediated by IL-8 and the tumor microenvironment
GSE10929 Comparison of consecutive microarray platforms

Data table header descriptions
ID Probe identifier (not unique across products and species but it is the ONLY unique id in these files)
Search_key Internal id useful for custom design array
Target transcript + type
Gid Genbank id
Transcript Internal transcript id
Accession Genbank accession number GB_ACC
GB_ACC
SPOT_ID
Symbol Gene symbol from the source database
Type Information about what this probe is targeting
Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Definition Gene description from the source
Ontology GO annotations from Gene Ontology project: The GO term will be separated by ; and each term will have up to 4 informations: the GO categories follow by (go_function, go_process and go_component) the term itself follow by its id between brackets (ex [goid 5783]), the evidence code and eventually the litterature reference also between brackets (see the Gene Ontology Project website)
Synonym Gene symbol synonyms from Refseq

Data table
ID Search_key Target Gid Transcript Accession GB_ACC SPOT_ID Symbol Type Start SEQUENCE Definition Ontology Synonym
2360044 PLAC3 GI_23097300-A GI_23097300 GI_23097300 NM_021936.1 NM_021936.1 PLAC3 A 3545 GCTTCACTCGCTTCCCAGGGGCTCCGTTCACCAACTACATGAGCTACACG Homo sapiens placenta-specific 3 (PLAC3), transcript variant 2, mRNA. PAPPE;PAPP-A2
3940446 COG4 GI_21070955-A GI_21070955 GI_21070955 NM_015386.1 NM_015386.1 COG4 A 2622 GCAGCCCAGGCCAGCTTTCTGCATGGATGGTCAGTCTCTTGCCCTCAAAC Homo sapiens component of oligomeric golgi complex 4 (COG4), mRNA. COD1;DKFZp586E1519
6420736 GI_4505876-A GI_4505876-A GI_4505876 GI_4505876 NM_000445.1 NM_000445.1 PLEC1 A 14736 AACACTAACCTGACCGTGGGCGGGGCCTTGCGGTATCCGCCCCCAATAAA Homo sapiens plectin 1, intermediate filament binding protein 500kDa (PLEC1), transcript variant 1, mRNA. go_component: intermediate filament [goid 0005882] [evidence NR]; go_component: cytoskeleton [goid 0005856] [evidence IEA]; go_component: kinesin complex [goid 0005871] [evidence IEA]; go_component: plasma membrane [goid 0005886] [evidence NR] [pmid 8633055]; go_function: structural constituent of muscle [goid 0008307] [evidence TAS] [pmid 8696340]; go_function: structural constituent of cytoskeleton [goid 0005200] [evidence NR]; go_function: actin binding [goid 0003779] [evidence IEA]; go_process: cytoskeletal anchoring [goid 0007016] [evidence NR] PCN;EBS1;EBSO;PLTN
2630279 PTPRD GI_18860893-A GI_18860893 GI_18860893 NM_130393.1 NM_130393.1 PTPRD A 4687 CTACAGGCCCTTCAATATCCATGGAGTCTCTTCTGAGCCATACAGGGCAC Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA. go_component: integral to plasma membrane [goid 0005887] [evidence TAS] [pmid 7896816]; go_function: transmembrane receptor protein tyrosine phosphatase activity [goid 0005001] [evidence TAS] [pmid 7896816]; go_function: receptor activity [goid 0004872] [evidence IEA]; go_function: prenylated protein tyrosine phosphatase activity [goid 0004727] [evidence IEA]; go_function: hydrolase activity [goid 0016787] [evidence IEA]; go_process: transmembrane receptor protein tyrosine phosphatase signaling pathway [goid 0007185] [evidence TAS] [pmid 7896816]; go_process: phosphate metabolism [goid 0006796] [evidence NR] [pmid 7896816]; go_process: protein amino acid dephosphorylation [goid 0006470] [evidence TAS] [pmid 7896816] HPTP;PTPD;HPTPD;HPTP-DELTA;R-PTP-DELTA
3120162 HS6ST2 GI_27597081-A GI_27597081 GI_27597081 NM_147174.2 NM_147174.2 HS6ST2 A 2272 CTGATAGGTATTGTTGGAAAGCAGGATGAAGCCTGAGCCAGTGGAAAAGC Homo sapiens heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), mRNA.
6900279 CPT1B GI_23238255-A GI_23238255 GI_23238255 NM_152246.1 NM_152246.1 CPT1B A 2373 CTTTTCCAAGTTCCCAAGGCCTACAGCTGAAGCCCTTAGGTACCTGTGTT Homo sapiens carnitine palmitoyltransferase 1B (muscle) (CPT1B), nuclear gene encoding mitochondrial protein, transcript variant 3, mRNA. go_component: mitochondrion [goid 0005739] [evidence P]; go_function: carnitine O-palmitoyltransferase activity [goid 0004095] [evidence P]; go_process: fatty acid beta-oxidation [goid 0006635] [evidence P] CPT1-M;M-CPT1;KIAA1670
1980670 B4GALT2 GI_13929463-A GI_13929463 GI_13929463 NM_003780.2 NM_003780.2 B4GALT2 A 1729 GATCTTGGGGTTGGCCTTTGCATGGGAGGCAGGTGGGGCTTGGATCAGTA Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 (B4GALT2), transcript variant 2, mRNA. go_function: galactosyltransferase activity [goid 0008378] [evidence E] [pmid 9405390] B4Gal-T2;B4Gal-T3;beta4Gal-T2
670603 SLC22A17 GI_27734993-A GI_27734993 GI_27734993 NM_016609.2 NM_016609.2 SLC22A17 A 1137 GGGAGGCTGGCCCACACAGAAAGGTGGCAAGAAGATCGGGAAGACTGAGT Homo sapiens solute carrier family 22 (organic cation transporter), member 17 (SLC22A17), transcript variant 2, mRNA. go_component: integral to membrane [goid 0016021] [evidence IEA]; go_function: transporter activity [goid 0005215] [evidence IEA]; go_process: transport [goid 0006810] [evidence IEA] BOCT;BOIT;hBOIT
4920152 SMAP-1 GI_8922201-A GI_8922201 GI_8922201 NM_017979.1 NM_017979.1 SMAP-1 A 922 GTTTACTGGACATGGGAGAGACTGACCTCATGCTGGCGGCTCTGCGTACG Homo sapiens smooth muscle cell associated protein-1 (SMAP-1), mRNA. FLJ10043;IRO039700
1240333 S100A4 GI_9845515-A GI_9845515 GI_9845515 NM_019554.1 NM_019554.1 S100A4 A 187 GCTGCCCAGCTTCTTGGGGAAAAGGACAGATGAAGCTGCTTTCCAGAAGC Homo sapiens S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4), transcript variant 2, mRNA. go_function: calcium ion binding [goid 0005509] [evidence TAS] [pmid 8204608]; go_process: invasive growth [goid 0007125] [evidence NR] 42A;18A2;CAPL;MTS1;P9KA;PEL98
6510707 TNFRSF19 GI_23238201-A GI_23238201 GI_23238201 NM_018647.2 NM_018647.2 TNFRSF19 A 942 TCGGATCCCTCACGCAGTCCATCTGTGGCGAGTTTTCAGATGCCTGGCCT Homo sapiens tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1, mRNA. go_component: integral to membrane [goid 0016021] [evidence NAS] [pmid 10809768]; go_function: tumor necrosis factor receptor activity [goid 0005031] [evidence NAS] [pmid 10809768]; go_function: receptor activity [goid 0004872] [evidence IEA]; go_process: JNK cascade [goid 0007254] [evidence NAS] [pmid 10809768]; go_process: induction of apoptosis [goid 0006917] [evidence NAS] [pmid 10809768]; go_process: apoptosis [goid 0006915] [evidence IEA] TAJ;TROY;TRADE;TAJ-alpha
2120377 KCNAB1 GI_27436965-A GI_27436965 GI_27436965 NM_172160.1 NM_172160.1 KCNAB1 A 3060 ATCCAGCGAACTGCTGTATGTATAGAGGAGCTGAGGTGCTGTCTAATGGG Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 1 (KCNAB1), transcript variant 1, mRNA. go_component: integral to membrane [goid 0016021] [evidence IEA]; go_component: cytoplasm [goid 0005737] [evidence NR]; go_function: potassium channel regulator activity [goid 0015459] [evidence TAS] [pmid 7499366]; go_function: voltage-gated potassium channel activity [goid 0005249] [evidence IEA]; go_process: potassium ion transport [goid 0006813] [evidence TAS] [pmid 7499366]; go_process: ion transport [goid 0006811] [evidence IEA] hKvb3;AKR6A3;KCNA1B;Kvb1.3;hKvBeta3;KV-BETA-1
5570131 OTOF GI_35493859-A GI_35493859 GI_35493859 NM_194323.1 NM_194323.1 OTOF A 4657 GCCCGTCAAGTGCTGCCCCTGCCTGTGTCTGGGTTTCTGTTGGCTGTTTT Homo sapiens otoferlin (OTOF), transcript variant 4, mRNA. go_component: membrane [goid 0016020] [evidence P] [pmid 10192385]; go_component: cytosol [goid 0005829] [evidence P] [pmid 10192385]; go_component: cellular_component unknown [goid 0008372] [evidence ND]; go_component: integral to membrane [goid 0016021] [evidence IEA] [pmid 10192385]; go_component: membrane fraction [goid 0005624] [evidence P] [pmid 10192385]; go_function: vesicle fusion [goid 0005481] [evidence P] [pmid 10192385]; go_function: molecular_function unknown [goid 0005554] [evidence ND]; go_process: hearing [goid 0007605] [evidence IEA] [pmid 10192385]; go_process: membrane fusion [goid 0006944] [evidence P] [pmid 10192385]; go_process: biological_process unknown [goid 0000004] [evidence ND] DFNB6;DFNB9;NSRD9;FER1L2
4120338 SLC19A1 GI_34808709-A GI_34808709 GI_34808709 NM_194255.1 NM_194255.1 SLC19A1 A 2548 GTCTGTCCTTCTGAAGTGTGTCCATCCTGACCTGCGGGTCCTCAGCTGCT Homo sapiens solute carrier family 19 (folate transporter), member 1 (SLC19A1), transcript variant 2, mRNA. go_component: membrane fraction [goid 0005624] [evidence P] [pmid 8276792]; go_component: integral to plasma membrane [goid 0005887] [evidence P] [pmid 7826387]; go_function: folate transporter activity [goid 0008517] [evidence E] [pmid 7826387]; go_function: methotrexate transporter activity [goid 0015350] [evidence E] [pmid 8276792]; go_process: folate transport [goid 0015884] [evidence E] [pmid 7826387] CHMD;FOLT;IFC1;REFC;RFC1
2190593 OTX3 GI_27436935-A GI_27436935 GI_27436935 NM_172225.1 NM_172225.1 OTX3 A 2458 CTTCTGTAGGCTTCCTGTCCCAGAGCCAATTATGGAAGTAAGGGCTTCCC Homo sapiens orthodenticle homolog 3 (Drosophila) (OTX3), transcript variant 1, mRNA. MBX;PAXB
1770215 AF3P21 GI_37577147-A GI_37577147 GI_37577147 NM_184231.1 NM_184231.1 NCKIPSD A 2797 CCTGGAGCCTCATGGAACAGGATGATGGCACTGAGAAAGCCAATGACCGA Homo sapiens NCK interacting protein with SH3 domain (NCKIPSD), transcript variant 2, mRNA. go_component: intermediate filament [goid 0005882] [evidence NAS] [pmid 10619843]; go_component: nucleus [goid 0005634] [evidence IEA]; go_function: cytoskeletal protein binding [goid 0008092] [evidence NAS] [pmid 10619843]; go_process: NLS-bearing substrate-nucleus import [goid 0006607] [evidence TAS] [pmid 10648423]; go_process: signal transduction [goid 0007165] [evidence TAS] [pmid 10648423]; go_process: cell growth and/or maintenance [goid 0008151] [evidence IEA]; go_process: cytoskeleton organization and biogenesis [goid 0007010] [evidence NAS] [pmid 10619843] DIP1;ORF1;WISH;AF3P21;SPIN90;WASLBP;MGC23891
780706 AP2A1 GI_19913415-A GI_19913415 GI_19913415 NM_130787.2 NM_130787.2 AP2A1 A 3158 CTCCACTGGTGACAGAGAAGACACCAGGGTTTGGGGGATGCCTGGGACTT Homo sapiens adaptor-related protein complex 2, alpha 1 subunit (AP2A1), transcript variant 2, mRNA. go_component: coated pit [goid 0005905] [evidence IEA]; go_component: Golgi apparatus [goid 0005794] [evidence IEA]; go_component: AP-2 adaptor complex [goid 0030122] [evidence NAS] [pmid 12036598]; go_component: clathrin coat of trans-Golgi network vesicle [goid 0030130] [evidence NAS] [pmid 12036598]; go_function: protein transporter activity [goid 0008565] [evidence IEA]; go_function: structural molecule activity [goid 0005198] [evidence IEA]; go_process: nonselective vesicle assembly [goid 0006902] [evidence P] [pmid 2564002]; go_process: endocytosis [goid 0006897] [evidence NAS] [pmid 12036598]; go_process: intracellular protein transport [goid 0006886] [evidence NAS] [pmid 12036598]; go_process: Golgi to endosome transport [goid 0006895] [evidence NAS] [pmid 12036598] ADTAA;CLAPA1;AP2-ALPHA
2100458 SLC22A1 GI_23510409-A GI_23510409 GI_23510409 NM_153187.1 NM_153187.1 SLC22A1 A 1513 GGGAGTGACGCTACTTCTTCCAGAGACCAAGGGGGTCGCTTTGCCAGAGA Homo sapiens solute carrier family 22 (organic cation transporter), member 1 (SLC22A1), transcript variant 2, mRNA. go_component: membrane fraction [goid 0005624] [evidence P] [pmid 9187257]; go_component: integral to plasma membrane [goid 0005887] [evidence P] [pmid 9187257]; go_component: integral to membrane [goid 0016021] [evidence IEA]; go_function: organic cation transporter activity [goid 0015101] [evidence P] [pmid 9187257]; go_function: ion transporter activity [goid 0015075] [evidence IEA]; go_process: organic cation transport [goid 0015695] [evidence E] [pmid 9187257]; go_process: ion transport [goid 0006811] [evidence IEA] OCT1;HOCT1
2680121 SOX30 GI_30581118-A GI_30581118 GI_30581118 NM_007017.2 NM_007017.2 SOX30 A 2018 CACAGCCCCGACATCAACTCCTTCTAGCATCCAGCAAGTCAATGTCACCG Homo sapiens SRY (sex determining region Y)-box 30 (SOX30), transcript variant 2, mRNA. go_component: nucleus [goid 0005634] [evidence IEA]; go_function: RNA polymerase II transcription factor activity [goid 0003702] [evidence TAS] [pmid 10359848]; go_function: DNA binding [goid 0003677] [evidence IEA]; go_function: translation regulator activity [goid 0045182] [evidence IEA]; go_process: spermatogenesis [goid 0007283] [evidence TAS] [pmid 10359848]; go_process: regulation of transcription from Pol II promoter [goid 0006357] [evidence TAS] [pmid 10359848]
1240112 KRT18 GI_40354193-A GI_40354193 GI_40354193 NM_000224.2 NM_000224.2 KRT18 A 1258 CCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACA Homo sapiens keratin 18 (KRT18), transcript variant 1, mRNA. go_component: intermediate filament [goid 0005882] [evidence TAS] [pmid 2434380]; go_component: kinesin complex [goid 0005871] [evidence IEA]; go_function: structural constituent of cytoskeleton [goid 0005200] [evidence NR]; go_process: embryogenesis and morphogenesis [goid 0007345] [evidence TAS] [pmid 2434380]; go_process: cell shape and cell size control [goid 0007148] [evidence NR]; go_process: morphogenesis [goid 0009653] [evidence TAS] K18;CYK18

Total number of rows: 47296

Table truncated, full table size 15110 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6097_Illumina_Human-6_V1.csv.gz 3.7 Mb (ftp)(http) CSV

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap