NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6101 Query DataSets for GPL6101
Status Public on Dec 13, 2007
Title Illumina ratRef-12 v1.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Rattus norvegicus
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The RatRef-12 Expression BeadChip includes twelve genome-scale, gene expression microarrays built using Illumina’s multi-sample Array of Arrays format. BeadChip content (22,523 probes per array) was selected from theNational Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) database.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://0-www.ncbi.nlm.nih.gov.brum.beds.ac.uk/projects/geo/info/spreadsheet.html
 
Submission date Nov 08, 2007
Last update date Jul 29, 2014
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (2864) GSM266857, GSM266858, GSM266859, GSM266860, GSM266861, GSM266862 
Series (137)
GSE10581 Nrf2-related oxidative stress response and impaired dopamine biosynthesis in a PC12 cell model of Huntington’s disease
GSE11574 The responses of astrocytes stimulated by extracellular a-synuclein
GSE12206 Genome-wide analysis of mechano-responsive gene expression by tenocytes in fascicles subjected to cyclic tensile strain

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Unigene_ID Unigene id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome built
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
GB_ACC
SPOT_ID

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Definition Ontology_Component Ontology_Process Ontology_Function Synonyms GB_ACC SPOT_ID
ILMN_1356720 Rattus norvegicus RefSeq GI_62644958-S ILMN_57573 LOC499782 XM_575115.1 XM_575115.1 499782 62644958 XM_575115.1 LOC499782 XP_575115.1 1570300 S 167 GAGAGTTGAGCTTTTCGGCCTATATCCGGCGTGGGCGGAGCAACATCCGT 3 + 11951869-11951918 PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L12 (LOC499782), mRNA. XM_575115.1
ILMN_1355539 Rattus norvegicus RefSeq GI_62643181-S ILMN_58017 LOC502515 XM_577999.1 XM_577999.1 502515 62643181 XM_577999.1 LOC502515 XP_577999.1 6840575 S 4804 CACACTGCCTGGAGGGGGACAGGAAGATTGAACTGGACATCCTGGTGATG 2 + 79187406-79187455 PREDICTED: Rattus norvegicus similar to AFL095Wp (LOC502515), mRNA. XM_577999.1
ILMN_1365415 Rattus norvegicus RefSeq GI_20301967-S ILMN_297955 PRSS8 NM_138836.1 NM_138836.1 192107 20301967 NM_138836.1 Prss8 NP_620191.1 4200670 S 2079 GGTTTCACCTTCACGGGATGAGAACAAAAGGGAGCTTTGGACCTGGGGGG 1 - 187210635-187210684 Rattus norvegicus protease, serine, 8 (prostasin) (Prss8), mRNA. integral to membrane [goid 16021] [evidence IEA]; extracellular space [goid 5615] [evidence IEA] serine-type endopeptidase activity [goid 4252] [evidence IEA]; serine-type peptidase activity [goid 8236] [pmid 11373334] [evidence IMP]; hydrolase activity [goid 16787] [evidence IEA]; trypsin activity [goid 4295] [evidence IEA]; chymotrypsin activity [goid 4263] [evidence IEA]; peptidase activity [goid 8233] [evidence IEA] NM_138836.1
ILMN_1373448 Rattus norvegicus RefSeq GI_62647669-S ILMN_54533 WBP1 XM_216198.4 XM_216198.4 297381 109472229 XM_216198.4 Wbp1 XP_216198.3 6620576 S 1750 TAGTCAAGGAGCTGAGGGCTAGTGCCACCCAACCAGACCTGGAGGACCAT 4 - 117331447-117331496 PREDICTED: Rattus norvegicus WW domain binding protein 1 (Wbp1), mRNA. XM_216198.4
ILMN_1353631 Rattus norvegicus RefSeq GI_62658996-S ILMN_289444 COX6A1 NM_012814.1 NM_012814.1 25282 77736543 NM_012814.1 Cox6a1 NP_036946.1 730300 S 393 CCACAGCACTGATTTGGACCCTGACTCTTGTGTGTGGACCACGAAAGCCC 12 + 42532988-42533037 Rattus norvegicus cytochrome c oxidase, subunit VIa, polypeptide 1 (Cox6a1), mRNA. membrane [goid 16020] [evidence IEA]; mitochondrion [goid 5739] [evidence IEA]; integral to membrane [goid 16021] [evidence IEA] electron transport [goid 6118] [evidence ISS] oxidoreductase activity [goid 16491] [evidence IEA]; cytochrome-c oxidase activity [goid 4129] [evidence ISS] COX6AL NM_012814.1
ILMN_2039365 Rattus norvegicus RefSeq GI_62656954-S ILMN_275442 IGFBP4 NM_001004274.2 NM_001004274.2 360622 70778853 NM_001004274.2 Igfbp4 NP_001004274.1 5360327 A 959 AAGGGGGAGCTGGACTGCCACCAACTGGCTGACAGCCTCCAAGAGTGAGA 10 + 87833110-87833157:87833158-87833159 Rattus norvegicus insulin-like growth factor binding protein 4 (Igfbp4), mRNA. extracellular region [goid 5576] [evidence IEA]; extracellular space [goid 5615] [evidence IEA] skeletal development [goid 1501] [evidence IEA]; DNA metabolism [goid 6259] [evidence IEA]; cell proliferation [goid 8283] [evidence IEA]; regulation of cell growth [goid 1558] [evidence IEA]; signal transduction [goid 7165] [evidence IEA] insulin-like growth factor binding [goid 5520] [evidence IEA]; growth factor binding [goid 19838] [evidence IEA] IBP4; IGF-BP4 NM_001004274.2
ILMN_1361828 Rattus norvegicus RefSeq GI_16758203-S ILMN_269790 PICK1 NM_053460.1 NM_053460.1 84591 16758203 NM_053460.1 Pick1 NP_445912.1 730072 S 1645 TGCAGGGAATGGGAGCTGGGTGGACATCCGAGGCTGTGACCAGTGTACCA 7 + 117232492-117232541 Rattus norvegicus protein interacting with C kinase 1 (Pick1), mRNA. plasma membrane [goid 5886] [evidence ISS]; presynaptic membrane [goid 42734] [evidence ISS]; Golgi apparatus [goid 5794] [evidence ISS]; mitochondrion [goid 5739] [evidence ISS]; perinuclear region [goid 48471] [evidence ISS] protein targeting [goid 6605] [evidence ISS]; monoamine transport [goid 15844] [evidence ISS]; receptor clustering [goid 43113] [evidence ISS]; DNA methylation during embryonic development [goid 43045] [evidence ISS]; protein homooligomerization [goid 51260] [evidence ISS]; dopamine transport [goid 15872] [evidence NAS]; development [goid 7275] [evidence ISS]; protein kinase C activation [goid 7205] [evidence ISS]; neuronal ion channel clustering [goid 45161] [evidence ISS]; DNA methylation during gametogenesis [goid 43046] [evidence ISS]; protein amino acid phosphorylation [goid 6468] [evidence ISS]; regulation of synapse structure and function [goid 50803] [evidence ISS] ATPase activity [goid 16887] [evidence ISS]; metabotropic glutatmate receptor binding [goid 35256] [evidence TAS]; ephrin receptor binding [goid 46875] [evidence TAS]; GTPase binding [goid 51020] [evidence TAS]; protein C-terminus binding [goid 8022] [evidence ISS]; protein kinase C binding [goid 5080] [evidence ISS]; receptor tyrosine kinase binding [goid 30971] [evidence TAS] Prkcabp NM_053460.1
ILMN_1371132 Rattus norvegicus RefSeq GI_12083670-S ILMN_302590 THEDC1 NM_022705.1 NM_022705.1 64669 12083670 NM_022705.1 Thedc1 NP_073196.1 6660377 S 1229 GGAGCATTTATCTCTCTGGGGAAAGGACACGGCTGAAGAGGCGCACAGGC 17 + 86020896-86020945 Rattus norvegicus thioesterase domain containing 1 (Thedc1), mRNA. fatty acid biosynthesis [goid 6633] [evidence IEA]; biosynthesis [goid 9058] [evidence IEA] thiolester hydrolase activity [goid 16790] [pmid 3632637] [evidence ISS]; hydrolase activity [goid 16787] [evidence IEA]; hydrolase activity, acting on ester bonds [goid 16788] [evidence IEA]; catalytic activity [goid 3824] [evidence IEA] Mch NM_022705.1
ILMN_1374582 Rattus norvegicus RefSeq GI_25742779-S ILMN_296021 DBH NM_013158.1 NM_013158.1 25699 25742779 NM_013158.1 Dbh NP_037290.1 3170167 S 2091 GAGTCCAGATTCAACTCCACAGGACCTCCCTTGCCTCCAGAACAGCCTTA 3 + 6069665-6069714 Rattus norvegicus dopamine beta hydroxylase (Dbh), mRNA. extracellular region [goid 5576] [evidence IEA]; membrane fraction [goid 5624] [evidence IEA]; membrane [goid 16020] [evidence IEA]; plasma membrane [goid 5886] [evidence ISS]; chromaffin granule [goid 42583] [evidence IEA]; soluble fraction [goid 5625] [evidence IEA]; cytoplasm [goid 5737] [evidence ISS] catecholamine metabolism [goid 6584] [evidence IEA]; synaptic transmission [goid 7268] [pmid 11858766] [evidence IEP]; catecholamine biosynthesis [goid 42423] [evidence IEA]; norepinephrine biosynthesis [goid 42421] [pmid 11914591] [evidence TAS]; response to pain [goid 48265] [evidence IEA] dopamine beta-monooxygenase activity [goid 4500] [pmid 2325165] [evidence TAS]; oxidoreductase activity [goid 16491] [evidence IEA]; copper ion binding [goid 5507] [pmid 2325165] [evidence ISS]; monooxygenase activity [goid 4497] [evidence IEA] DOPBHY NM_013158.1
ILMN_1359915 Rattus norvegicus RefSeq GI_62649883-S ILMN_52371 LOC502991 XM_578499.1 XM_578499.1 502991 62649883 XM_578499.1 LOC502991 XP_578499.1 6840397 S 312 CACCTCCACATTCAGCGGTACACCATGAAGATGCTGAACTTCCAGGGCGC 5 + 154782593-154782642 PREDICTED: Rattus norvegicus similar to RIKEN cDNA 2310005N03 (LOC502991), mRNA. XM_578499.1
ILMN_1366207 Rattus norvegicus RefSeq GI_62661954-S ILMN_47765 LOC502011 XM_577439.1 XM_577439.1 502011 62661954 XM_577439.1 LOC502011 XP_577439.1 3290373 S 478 GCATTGTCTGGATTTCCTACGACCCCGCTCGCTTTCCGAGATACCTGCCC 15 + 36582451-36582461:36582862-36582900 PREDICTED: Rattus norvegicus similar to IL-17D (LOC502011), mRNA. XM_577439.1
ILMN_1353331 Rattus norvegicus RefSeq GI_62647604-S ILMN_51437 LOC502843 XM_578343.1 XM_578343.1 502843 62647604 XM_578343.1 LOC502843 XP_578343.1 5340142 S 205 AACTGCTTATCTATGGGGCATCCAACCGGTACACTGGAGTCCCTGATCGC 4 + 103831056-103831105 PREDICTED: Rattus norvegicus similar to immunoglobulin kappa-chain (LOC502843), mRNA. XM_578343.1
ILMN_1353943 Rattus norvegicus RefSeq GI_57528406-S ILMN_264783 LRG1 NM_001009717.1 NM_001009717.1 367455 57528406 NM_001009717.1 Lrg1 NP_001009717.1 1400168 S 989 CAGAGCTGGGGACCTTGTGAGGATGGCAACTGGGGTGCGAGCCAAGGGTA Un|NW_047865.1 + 974723-974742:974743-974772 Rattus norvegicus leucine-rich alpha-2-glycoprotein 1 (Lrg1), mRNA. membrane [goid 16020] [evidence IEA]; extracellular region [goid 5576] [evidence IEA]; extracellular space [goid 5615] [evidence IEA] MGC95065 NM_001009717.1
ILMN_1366701 Rattus norvegicus RefSeq GI_62666981-S ILMN_290144 RGD1563383_PREDICTED XR_007834.1 XR_007834.1 317533 109511851 XR_007834.1 RGD1563383_predicted 1580465 S 2125 CATTACCCACCTTTAGAGGCCAGACAGCAAATGCATGTTATAAGCCCAGA X - 46340236-46340285 PREDICTED: Rattus norvegicus similar to hypothetical protein 4930595M18 (predicted) (RGD1563383_predicted), mRNA. XR_007834.1
ILMN_1357309 Rattus norvegicus RefSeq GI_13162352-S ILMN_291360 CFI NM_024157.1 NM_024157.1 79126 13162352 NM_024157.1 Cfi NP_077071.1 2900176 S 1582 GAGATGCAGTGTGCGGGTACCAGTGATGGGTCCATTGATGCCTGCAAAGG 2 + 227325092-227325109 Rattus norvegicus complement factor I (Cfi), mRNA. extracellular region [goid 5576] [evidence IEA]; membrane [goid 16020] [evidence IEA]; extracellular space [goid 5615] [evidence IEA] complement activation [goid 6956] [evidence IEA]; complement activation, classical pathway [goid 6958] [evidence IEA] serine-type endopeptidase activity [goid 4252] [evidence IEA]; serine-type peptidase activity [goid 8236] [evidence ISS]; hydrolase activity [goid 16787] [evidence IEA]; scavenger receptor activity [goid 5044] [evidence IEA]; trypsin activity [goid 4295] [evidence IEA]; chymotrypsin activity [goid 4263] [evidence IEA]; complement factor I activity [goid 3818] [evidence IEA] NM_024157.1
ILMN_1350712 Rattus norvegicus RefSeq GI_62641152-S ILMN_49251 USP47_PREDICTED XM_218997.4 XM_218997.4 308896 109459235 XM_218997.4 Usp47_predicted XP_218997.3 4780180 S 5430 CATCGTATGGAATAGTTTCTCGGGGGCCTTGGTGCAGACCTGGTGCCACA 1 + 169919812-169919861 PREDICTED: Rattus norvegicus ubiquitin specific protease 47 (predicted) (Usp47_predicted), mRNA. XM_218997.4
ILMN_1370136 Rattus norvegicus RefSeq GI_62659480-S ILMN_50037 RGL1_PREDICTED XM_222717.4 XM_222717.4 289080 109498017 XM_222717.4 Rgl1_predicted XP_222717.4 2810064 S 2392 AGGACAGCTAAGCGGGGCTGCTGGAGTAACAGACACAGCAAGGTCACCCT 13 - 67469699-67469748 PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator,-like 1 (predicted) (Rgl1_predicted), mRNA. XM_222717.4
ILMN_1373899 Rattus norvegicus RefSeq GI_9507082-S ILMN_301015 SEMA4F NM_019272.1 NM_019272.1 29745 9507082 NM_019272.1 Sema4f NP_062145.1 6450402 S 3820 CCCCTTGGTTTGGAGTTCCCGGTGGCTTTGAGTAGGATCTTTGGCGTGGC 4 - 117104765-117104814 Rattus norvegicus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F (Sema4f), mRNA. plasma membrane [goid 5886] [evidence IEA]; synapse [goid 45202] [evidence IEA]; integral to membrane [goid 16021] [evidence IEA]; postsynaptic membrane [goid 45211] [evidence IEA]; membrane fraction [goid 5624] [evidence IEA]; integral to plasma membrane [goid 5887] [evidence IEA]; integral to membrane of membrane fraction [goid 299] [evidence IEA]; synaptosome [goid 19717] [evidence IEA] cell-cell signaling [goid 7267] [evidence IEA]; negative regulation of axon extension [goid 30517] [evidence IEA]; cell differentiation [goid 30154] [evidence IEA]; axon guidance [goid 7411] [evidence IEA] protein binding [goid 5515] [evidence IEA] NM_019272.1
ILMN_1360341 Rattus norvegicus RefSeq GI_62649471-S ILMN_278092 LOC298442 NM_001025656.1 NM_001025656.1 298442 71043663 NM_001025656.1 LOC298442 NP_001020827.1 5340044 S 1327 GGGAACTCCAGAACAACTCCCTTTCTAACCTGGAACCCAGCAGCTCTCAG 5 + 137006761-137006763:137007447-137007493 Rattus norvegicus similar to RIKEN cDNA 0610037D15 (LOC298442), mRNA. MGC114580 NM_001025656.1
ILMN_1530174 Rattus norvegicus Unigene Rn.49412 ILMN_160524 RN.49412 Rn.49412 Rn.49412 14960831 BI296422 4230017 S 36 TTCTTATTTTTCTTTCATTAGCAAACATACAAATGGGTAGAGTGAACCCT UI-R-CV2-cgr-a-06-0-UI.s1 UI-R-CV2 Rattus norvegicus cDNA clone UI-R-CV2-cgr-a-06-0-UI 3', mRNA Rn.49412

Total number of rows: 22523

Table truncated, full table size 10091 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6101_Illumina_RatRef-12_V1_0_R1_11222119_A.bgx.gz 2.8 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap