NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6104 Query DataSets for GPL6104
Status Public on Dec 13, 2007
Title Illumina humanRef-8 v2.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description Researchers can generate whole genome expression profiles for multiple samples on a single BeadChip. Researchers can profile six or eight samples perBeadChip, with more than 22,000 transcript probes using the HumanRef-8 v2 beadchip.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://0-www.ncbi.nlm.nih.gov.brum.beds.ac.uk/projects/geo/info/spreadsheet.html
 
Submission date Nov 08, 2007
Last update date Jan 18, 2013
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (6337) GSM265549, GSM265550, GSM265551, GSM265552, GSM277495, GSM277496 
Series (137)
GSE10003 Gene expression profile of H187-63AR, an ABT-737 resistant derivative of H187
GSE10950 Comparing gene expression in human colon tumor vs paired normal colon mucosa
GSE10952 Gene expression in colon cancer cell lines
Relations
Alternative to GPL5060
Alternative to GPL5104
Alternative to GPL6014
Alternative to GPL6255

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome build 36 version 3
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
GB_ACC

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Definition Ontology_Component Ontology_Process Ontology_Function Synonyms GB_ACC
ILMN_1698220 Homo sapiens RefSeq ILMN_13666 ILMN_13666 PHTF2 NM_020432.2 NM_020432.2 57157 40254932 NM_020432.2 PHTF2 NP_065165.2 2900438 S 4677 CAAAGAGAATTGTGGCAGATGTTGTGTGTGAACTGTTGTTTCTTTGCCAC 7 + 77424374-77424423 Homo sapiens putative homeodomain transcription factor 2 (PHTF2), mRNA. endoplasmic reticulum [goid 5783] [pmid 11256614] [evidence IDA] DKFZP564F013; FLJ33324; MGC86999 NM_020432.2
ILMN_1810835 Homo sapiens RefSeq ILMN_10478 ILMN_175835 SPRR3 NM_005416.1 NM_005416.1 6707 4885606 NM_005416.1 SPRR3 NP_005407.1 2640692 S 683 GAAGCCAACCACCAGATGCTGGACACCCTCTTCCCATCTGTTTCTGTGTC 1 + 151242655-151242704 Homo sapiens small proline-rich protein 3 (SPRR3), mRNA. cornified envelope [goid 1533] [pmid 15232223] [evidence TAS] keratinocyte differentiation [goid 30216] [pmid 8325635] [evidence NAS]; wound healing [goid 42060] [pmid 10510474] [evidence TAS]; epidermis development [goid 8544] [pmid 8325635] [evidence NAS]; keratinization [goid 31424] [evidence IEA] structural molecule activity [goid 5198] [pmid 15232223] [evidence TAS]; protein binding [goid 5515] [pmid 10510474] [evidence IPI] NM_005416.1
ILMN_1782944 Homo sapiens RefSeq ILMN_27850 ILMN_27850 GPR37L1 NM_004767.2 NM_004767.2 9283 31377792 NM_004767.2 GPR37L1 NP_004758.2 1690440 S 2372 GATCCCTGGGTTGCCCTGTCCCAACCTCCTTGTTAGGTGCTTTCCCATAG 1 + 200365170-200365219 Homo sapiens G protein-coupled receptor 37 like 1 (GPR37L1), mRNA. membrane [goid 16020] [evidence IEA]; integral to membrane [goid 16021] [pmid 9539149] [evidence NAS] G-protein coupled receptor protein signaling pathway [goid 7186] [evidence IEA]; signal transduction [goid 7165] [evidence IEA] receptor activity [goid 4872] [evidence IEA]; G-protein coupled receptor activity, unknown ligand [goid 16526] [pmid 9539149] [evidence NAS]; rhodopsin-like receptor activity [goid 1584] [evidence IEA] ET(B)R-LP-2; ETBR-LP-2 NM_004767.2
ILMN_1692858 Homo sapiens RefSeq ILMN_10309 ILMN_10309 FBXO25 NM_012173.3 NM_012173.3 26260 34878756 NM_012173.3 FBXO25 NP_036305.2 1030747 A 1937 CTGGGGTTGGGGGCTGGTCTGTGCATAATCCTGGACTGTGATGGGAACAG 8 + 409448-409497 Homo sapiens F-box protein 25 (FBXO25), transcript variant 3, mRNA. ubiquitin ligase complex [goid 151] [pmid 10531035] [evidence NAS] protein ubiquitination [goid 16567] [pmid 10531035] [evidence NAS] ubiquitin-protein ligase activity [goid 4842] [pmid 10531035] [evidence NAS] MGC51975; MGC20256; FBX25 NM_012173.3
ILMN_1668162 Homo sapiens RefSeq ILMN_7652 ILMN_7652 DGAT2L3 NM_001013579.1 NM_001013579.1 158833 61888901 NM_001013579.1 DGAT2L3 NP_001013597.1 6480482 S 782 GTCAAGGCTCCACTGGGCTCCTGCCATACTCCAGGCCTATTGTCACTGTG X + 69376459-69376508 Homo sapiens diacylglycerol O-acyltransferase 2-like 3 (DGAT2L3), mRNA. membrane [goid 16020] [evidence IEA]; integral to membrane [goid 16021] [evidence IEA]; endoplasmic reticulum [goid 5783] [evidence IEA] lipid biosynthesis [goid 8610] [evidence IEA]; lipid metabolism [goid 6629] [evidence IEA] acyltransferase activity [goid 8415] [evidence IEA]; transferase activity [goid 16740] [evidence IEA] AWAT1; DGA2 NM_001013579.1
ILMN_1682799 Homo sapiens RefSeq ILMN_1387 ILMN_1387 STAMBPL1 NM_020799.2 NM_020799.2 57559 52694663 NM_020799.2 STAMBPL1 NP_065850.1 7160255 S 1746 TGTAAGCACCGTCAACATCAGACACCTACTCATGGACATGTGGTTGCCGG 10 + 90672973-90673022 Homo sapiens STAM binding protein-like 1 (STAMBPL1), mRNA. ubiquitin cycle [goid 6512] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; metallopeptidase activity [goid 8237] [evidence IEA]; ubiquitin thiolesterase activity [goid 4221] [evidence IEA] bA399O19.2; AMSH-LP; ALMalpha; KIAA1373; FLJ31524; AMSH-FP NM_020799.2
ILMN_1696317 Homo sapiens RefSeq ILMN_15285 ILMN_17773 CACNA2D4 NM_001005766.1 NM_001005766.1 93589 54607061 NM_001005766.1 CACNA2D4 NP_001005766.1 1470386 A 4998 GCCCCCTTACAGCAGAAGACACTGCAGCTCGAAGACAGCTTAAGTGGCAG 12 - 1771634-1771683 Homo sapiens calcium channel, voltage-dependent, alpha 2/delta subunit 4 (CACNA2D4), transcript variant 3, mRNA. membrane [goid 16020] [evidence IEA] RCD4 NM_001005766.1
ILMN_1669181 Homo sapiens RefSeq ILMN_138201 ILMN_12798 ACOX1 NM_004035.5 NM_004035.5 51 83641871 NM_004035.5 ACOX1 NP_004026.2 3450138 I 603 GGCATGTTCCTGCCCACCTTGCTTCACCAGGCAACTGCGGAGCAGCAGGA 17 - 71467958-71468007 Homo sapiens acyl-Coenzyme A oxidase 1, palmitoyl (ACOX1), transcript variant 1, mRNA. peroxisome [goid 5777] [pmid 7876265] [evidence NAS] prostaglandin metabolism [goid 6693] [pmid 7876265] [evidence NAS]; fatty acid beta-oxidation [goid 6635] [evidence IEA]; lipid metabolism [goid 6629] [pmid 8159712] [evidence TAS]; electron transport [goid 6118] [evidence IEA] acyl-CoA dehydrogenase activity [goid 3995] [evidence IEA]; oxidoreductase activity [goid 16491] [evidence IEA]; electron donor activity [goid 9053] [evidence NR ]; acyl-CoA oxidase activity [goid 3997] [pmid 7876265] [evidence NAS]; FAD binding [goid 50660] [evidence IEA] SCOX; MGC1198; ACOX; PALMCOX NM_004035.5
ILMN_1665311 Homo sapiens RefSeq ILMN_1785 ILMN_1785 STH NM_001007532.1 NM_001007532.1 246744 56090268 NM_001007532.1 STH NP_001007533.1 1050195 S 97 CAGCCTCTGTGTGAGTGGATGATTCAGGTTGCCAGAGACAGAACCCTCAG 17 + 41432579-41432628 Homo sapiens saitohin (STH), mRNA. MGC163193; MGC163191 NM_001007532.1
ILMN_1734631 Homo sapiens RefSeq ILMN_28546 ILMN_179976 CLYBL NM_138280.3 NM_138280.3 171425 45580744 NM_138280.3 CLYBL NP_612124.3 5550445 I 2073 GTAACTCAGAGTCCCATTCCACAAGCCCATGCTAGTGAGCCAACACAAAC 13 + 99359185-99359234 Homo sapiens citrate lyase beta like (CLYBL), transcript variant 1, mRNA. citrate lyase complex [goid 9346] [evidence IEA] aromatic compound metabolism [goid 6725] [evidence IEA] carbon-carbon lyase activity [goid 16830] [evidence IEA]; citrate (pro-3S)-lyase activity [goid 8815] [evidence IEA] bA134O15.1; CLB NM_138280.3
ILMN_1711453 Homo sapiens RefSeq ILMN_24114 ILMN_24114 CLEC12A NM_201625.1 NM_201625.1 160364 42490743 NM_201625.1 CLEC12A NP_963919.1 4210615 I 481 GCCCACAAGGAGGACTTACAATGTGGAACTTAGTCTCTTTCCCTCACTCC 12 + 10023039-10023088 Homo sapiens C-type lectin domain family 12, member A (CLEC12A), transcript variant 3, mRNA. sugar binding [goid 5529] [evidence IEA]; receptor activity [goid 4872] [evidence IEA] CLL1; MICL; CLL-1; DCAL-2; MGC70602 NM_201625.1
ILMN_1784717 Homo sapiens RefSeq ILMN_30266 ILMN_30266 RPS19 NM_001022.3 NM_001022.3 6223 48255921 NM_001022.3 RPS19 NP_001013.1 4250487 S 739 CTGACACCTCAGGGACAAAGAGATCTGGACAGAATCGCCGGACAGGTGGC 19 + 47065619-47065663:47067259-47067263 Homo sapiens ribosomal protein S19 (RPS19), mRNA. nucleolus [goid 5730] [pmid 16289379] [evidence IDA]; ribosome [goid 5840] [evidence IEA]; intracellular [goid 5622] [evidence IEA]; cytosolic small ribosomal subunit (sensu Eukaryota) [goid 5843] [pmid 15883184] [evidence IDA] positive regulation of cell motility [goid 51272] [pmid 16289379] [evidence TAS]; response to extracellular stimulus [goid 9991] [pmid 16289379] [evidence TAS]; protein biosynthesis [goid 6412] [pmid 9988267] [evidence TAS]; erythrocyte differentiation [goid 30218] [pmid 16289379] [evidence IMP] RNA binding [goid 3723] [pmid 9988267] [evidence TAS]; structural constituent of ribosome [goid 3735] [pmid 15883184] [evidence IDA]; protein binding [goid 5515] [pmid 11716516] [evidence IPI] DBA NM_001022.3
ILMN_1702928 Homo sapiens RefSeq ILMN_4617 ILMN_4500 FBXO9 NM_012347.4 NM_012347.4 26268 117190362 NM_012347.4 FBXO9 NP_036479.1 6520670 A 2992 AGGTGAAATGTGCATACAGAAGGAAGAGAGTTGGCCAGGTGTGGTGACTC Homo sapiens F-box protein 9 (FBXO9), transcript variant 1, mRNA. ubiquitin ligase complex [goid 151] [pmid 10531037] [evidence NAS] protein ubiquitination [goid 16567] [pmid 10531037] [evidence NAS] binding [goid 5488] [evidence IEA]; ubiquitin-protein ligase activity [goid 4842] [pmid 10531037] [evidence NAS] dJ341E18.2; DKFZp434C0118; NY-REN-57; KIAA0936; FBX9; VCIA1 NM_012347.4
ILMN_1667120 Homo sapiens RefSeq ILMN_4500 ILMN_4500 FBXO9 NM_012347.4 NM_012347.4 26268 117190362 NM_012347.4 FBXO9 NP_036479.1 7330253 I 33 GGGCAACTGGTGTGTTTATATGCCTGACATTATTTGGGTTTTCCCCCCTC Homo sapiens F-box protein 9 (FBXO9), transcript variant 1, mRNA. ubiquitin ligase complex [goid 151] [pmid 10531037] [evidence NAS] protein ubiquitination [goid 16567] [pmid 10531037] [evidence NAS] binding [goid 5488] [evidence IEA]; ubiquitin-protein ligase activity [goid 4842] [pmid 10531037] [evidence NAS] dJ341E18.2; DKFZp434C0118; NY-REN-57; KIAA0936; FBX9; VCIA1 NM_012347.4
ILMN_1761911 Homo sapiens RefSeq ILMN_18324 ILMN_18324 SCYL1BP1 NM_152281.1 NM_152281.1 92344 22748638 NM_152281.1 SCYL1BP1 NP_689494.1 3930743 S 1385 TCTAGGGGTATGTTTCACCTTGATTTTGGCCCGGTTCTTTCAGTGTTCCG 1 + 168788407-168788456 Homo sapiens SCY1-like 1 binding protein 1 (SCYL1BP1), mRNA. cytoplasm [goid 5737] [pmid 12783284] [evidence ISS] protein binding [goid 5515] [pmid 15781263] [evidence IPI] NTKL-BP1; MGC51263; NTKLBP1; FLJ11752; MGC70512; RP11-545I10.1 NM_152281.1
ILMN_1706784 Homo sapiens RefSeq ILMN_29030 ILMN_29030 H2AFV NM_138635.2 NM_138635.2 94239 41406072 NM_138635.2 H2AFV NP_619541.1 2850612 I 565 GCTGAACCAAGGAACTGCCCGAATGTGCTGAACAAGGACATTTGCTTCTC 7 - 44836137-44836186 Homo sapiens H2A histone family, member V (H2AFV), transcript variant 2, mRNA. chromosome [goid 5694] [evidence IEA]; nucleus [goid 5634] [evidence IEA]; nucleosome [goid 786] [evidence IEA] nucleosome assembly [goid 6334] [evidence IEA]; chromosome organization and biogenesis (sensu Eukaryota) [goid 7001] [evidence IEA] DNA binding [goid 3677] [evidence IEA] MGC1947; H2AV; MGC10831; FLJ26479; MGC10170 NM_138635.2
ILMN_1751493 Homo sapiens RefSeq ILMN_20676 ILMN_169445 NPFFR2 NM_004885.1 NM_004885.1 10886 4758819 NM_004885.1 NPFFR2 NP_004876.1 3610215 I 263 GGGGGACAGACGTCGGCTGGGATTGAGCCGGCAGACTGCGAAAAGTAGCT 4 + 73116647-73116696 Homo sapiens neuropeptide FF receptor 2 (NPFFR2), transcript variant 1, mRNA. integral to plasma membrane [goid 5887] [pmid 10079187] [evidence TAS]; membrane [goid 16020] [evidence IEA] G-protein coupled receptor protein signaling pathway [goid 7186] [pmid 10079187] [evidence TAS]; signal transduction [goid 7165] [evidence IEA]; detection of abiotic stimulus [goid 9582] [pmid 10851242] [evidence TAS] neuropeptide receptor activity [goid 8188] [evidence IEA]; receptor activity [goid 4872] [evidence IEA]; rhodopsin-like receptor activity [goid 1584] [evidence IEA] NPFF2; NPGPR; GPR74 NM_004885.1
ILMN_1815346 Homo sapiens RefSeq ILMN_16309 ILMN_16309 TMEM136 NM_174926.1 NM_174926.1 219902 28376667 NM_174926.1 TMEM136 NP_777586.1 6180670 S 694 CCATGCTTGGAGAAGCAGGCGGAGTGAGGAACGGCAGCTGAAACACAACG 11 + 119706365-119706414 Homo sapiens transmembrane protein 136 (TMEM136), mRNA. integral to membrane [goid 16021] [evidence IEA] MGC17839 NM_174926.1
ILMN_1774687 Homo sapiens RefSeq ILMN_3497 ILMN_3497 PRKAG1 NM_002733.3 NM_002733.3 5571 47132573 NM_002733.3 PRKAG1 NP_002724.1 7150377 A 1527 CCATAATGTGAGTGGGGAGGATTGTGGGGAGGAGGGGCTTTGGGTTCCTG 12 - 47682437-47682486 Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 1, mRNA. fatty acid biosynthesis [goid 6633] [evidence IEA]; protein amino acid phosphorylation [goid 6468] [pmid 2342480] [evidence TAS]; signal transduction [goid 7165] [pmid 2342480] [evidence TAS]; spermatogenesis [goid 7283] [pmid 9598317] [evidence TAS] cAMP-dependent protein kinase activity [goid 4691] [pmid 9598317] [evidence TAS] AMPKG; MGC8666 NM_002733.3
ILMN_1764927 Homo sapiens RefSeq ILMN_9221 ILMN_166833 CDC42EP1 NM_152243.1 NM_152243.1 11135 23238225 NM_152243.1 CDC42EP1 NP_689449.1 730768 A 2005 CCAACATCCCCGCCCCAGCCTCCCTCTTACCCCAGAAAGGTCAGGTATGA 22 + 36295228-36295277 Homo sapiens CDC42 effector protein (Rho GTPase binding) 1 (CDC42EP1), transcript variant 1, mRNA. regulation of cell shape [goid 8360] [pmid 11035016] [evidence IDA]; positive regulation of pseudopodium formation [goid 31274] [pmid 11035016] [evidence IDA] MGC15316; MSE55; CEP1; BORG5 NM_152243.1

Total number of rows: 22185

Table truncated, full table size 13363 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6104_Illumina_HumanRef-8_V2_0_R1_11223162_A.bgx.gz 3.4 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap