GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Platform GPL6883 Query DataSets for GPL6883
Status Public on May 21, 2008
Title Illumina HumanRef-8 v3.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
Description The HumanRef-8 v3.0 Expression BeadChip features up-to-date content derived from the National Center for Biotechnology Information Reference Sequence (NCBI RefSeq) database (Build 36.2, Release 22).

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at
Submission date May 21, 2008
Last update date Mar 20, 2017
Organization Illumina Inc.
Phone 1 800 809 4566
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
Samples (7128) GSM303492, GSM303494, GSM303496, GSM303498, GSM328683, GSM328700 
Series (229)
GSE12002 Transcriptional profiles of Ad-F7 transduced macrophages treated with anti-IFNAR2 antibody or control isotype (IgG)
GSE12120 Transcriptional re-programming of primary human macrophages by IRF-3 and IRF-7
GSE13131 Gene expression profiling of LNCaP and PC-3 prostate cancer cell lines
Alternative to GPL10399 (gene-centered version)
Alternative to GPL16221
Alternative to GPL18405 (addtnl control probes)

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome build 36 version 3
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms GB_ACC
ILMN_1722532 Homo sapiens RefSeq ILMN_25544 ILMN_25544 JMJD1A NM_018433.3 NM_018433.3 55818 46358420 NM_018433.3 JMJD1A NP_060903.2 1240504 S 4359 CCAGGCTGTAAAAGCAAAACCTCGTATCAGCTCTGGAACAATACCTGCAG 2 + 86572991-86573040 2p11.2e Homo sapiens jumonji domain containing 1A (JMJD1A), mRNA. nucleus [goid 5634] [evidence IEA] chromatin modification [goid 16568] [evidence IEA]; transcription [goid 6350] [evidence IEA]; regulation of transcription, DNA-dependent [goid 6355] [evidence IEA] oxidoreductase activity [goid 16491] [evidence IEA]; oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [goid 16702] [evidence IEA]; zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; iron ion binding [goid 5506] [evidence IEA] JHMD2A; JMJD1; TSGA; KIAA0742; DKFZp686A24246; DKFZp686P07111 NM_018433.3
ILMN_1708805 Homo sapiens RefSeq ILMN_10519 ILMN_10519 NCOA3 NM_006534.2 NM_006534.2 8202 32307123 NM_006534.2 NCOA3 NP_006525.2 2760390 A 7834 CCACATGAAATGACTTATGGGGGATGGTGAGCTGTGACTGCTTTGCTGAC 20 + 45718934-45718983 20q13.12c Homo sapiens nuclear receptor coactivator 3 (NCOA3), transcript variant 2, mRNA. nucleus [goid 5634] [pmid 9267036] [evidence NAS] positive regulation of transcription, DNA-dependent [goid 45893] [pmid 15572661] [evidence NAS]; androgen receptor signaling pathway [goid 30521] [pmid 15572661] [evidence NAS]; signal transduction [goid 7165] [evidence IEA] acyltransferase activity [goid 8415] [evidence IEA]; thyroid hormone receptor binding [goid 46966] [pmid 9346901] [evidence NAS]; transferase activity [goid 16740] [evidence IEA]; transcription coactivator activity [goid 3713] [pmid 15572661] [evidence NAS]; androgen receptor binding [goid 50681] [pmid 15572661] [evidence NAS]; histone acetyltransferase activity [goid 4402] [pmid 9267036] [evidence TAS]; signal transducer activity [goid 4871] [evidence IEA]; transcription regulator activity [goid 30528] [evidence IEA]; protein binding [goid 5515] [pmid 15698540] [evidence IPI] CAGH16; TNRC14; pCIP; ACTR; MGC141848; CTG26; AIB-1; TRAM-1; TNRC16; AIB1; SRC3; SRC-1; RAC3 NM_006534.2
ILMN_1672526 Homo sapiens RefSeq ILMN_17234 ILMN_17234 LOC389834 NM_001013655.1 NM_001013655.1 389834 61966764 NM_001013655.1 LOC389834 NP_001013677.1 1740239 S 3938 CCATTGGTTCTGTTTGGCATAACCCTATTAAATGGTGCGCAGAGCTGAAT 4 - 51062-51111 Homo sapiens hypothetical gene supported by AK123403 (LOC389834), mRNA. NM_001013655.1
ILMN_1703284 Homo sapiens RefSeq ILMN_502 ILMN_502 SPIRE2 NM_032451.1 NM_032451.1 84501 55749599 NM_032451.1 SPIRE2 NP_115827.1 6040014 S 3080 ACATGTGTCCTGCCTCTCCTGGCCCTACCACATTCTGGTGCTGTCCTCAC 16 + 88465064-88465113 16q24.3b Homo sapiens spire homolog 2 (Drosophila) (SPIRE2), mRNA. zinc ion binding [goid 8270] [evidence IEA] MGC117166; Spir-2 NM_032451.1
ILMN_2185604 Homo sapiens RefSeq ILMN_19244 ILMN_19244 C17ORF77 NM_152460.2 NM_152460.2 146723 48255961 NM_152460.2 C17orf77 NP_689673.2 6550343 S 2372 CTGCTCCAGTGAAGGGTGCACCAAAATCTCAGAAGTCACTGCTAAAGACC 17 + 70101790-70101839 17q25.1b Homo sapiens chromosome 17 open reading frame 77 (C17orf77), mRNA. FLJ31882 NM_152460.2
ILMN_1785107 Homo sapiens RefSeq ILMN_1567 ILMN_1567 NXT2 NM_018698.3 NM_018698.3 55916 21361723 NM_018698.3 NXT2 NP_061168.2 5270307 S 2605 ATGGCTGGAACTACTCGTATAAGGACTAGACTGTATTTTTGACATGCTCC X + 108674482-108674531 Xq22.3c Homo sapiens nuclear transport factor 2-like export factor 2 (NXT2), mRNA. intracellular [goid 5622] [evidence IEA]; nucleus [goid 5634] [evidence IEA] mRNA processing [goid 6397] [evidence IEA]; transport [goid 6810] [evidence IEA]; protein transport [goid 15031] [evidence IEA] transporter activity [goid 5215] [evidence IEA] P15-2 NM_018698.3
ILMN_1689711 Homo sapiens RefSeq ILMN_2520 ILMN_2520 CHKB NM_152253.1 NM_152253.1 1120 23238260 NM_152253.1 CHKB NP_689466.1 5810382 I 953 CTAAATAAAAATAGACCAACGCTAAAGCCTGTGCTCCAGAGCCTCCAGGC 22q13.33b Homo sapiens choline kinase beta (CHKB), transcript variant 2, mRNA. transferase activity [goid 16740] [evidence IEA]; ethanolamine kinase activity [goid 4305] [evidence IEA] CHKL; CHETK NM_152253.1
ILMN_1782551 Homo sapiens RefSeq ILMN_17249 ILMN_17249 E2F5 NM_001951.2 NM_001951.2 1875 12669916 NM_001951.2 E2F5 NP_001942.1 6650196 S 957 CTTCTGACGTGTTTCCTCTCTTAAGGCTTTCTCCTACCCCGGCAGATGAC 8 + 86311683-86311691:86313240-86313280 8q21.2b Homo sapiens E2F transcription factor 5, p130-binding (E2F5), mRNA. transcription factor complex [goid 5667] [evidence IEA]; nucleus [goid 5634] [evidence IEA] transcription [goid 6350] [evidence IEA]; regulation of transcription, DNA-dependent [goid 6355] [evidence IEA] protein binding [goid 5515] [pmid 7760804] [evidence TAS]; transcription factor activity [goid 3700] [pmid 7892279] [evidence NAS] E2F-5 NM_001951.2
ILMN_1656040 Homo sapiens RefSeq ILMN_6765 ILMN_6765 NTN2L NM_006181.1 NM_006181.1 4917 5453809 NM_006181.1 NTN2L NP_006172.1 6400669 S 1571 AAAGAAGTTCTGCAAGAAGGACTATGCGGTGCAGGTGGCGGTGGGTGCGC 16 + 2463480-2463505:2463758-2463781 16p13.3d Homo sapiens netrin 2-like (chicken) (NTN2L), mRNA. extracellular matrix (sensu Metazoa) [goid 5578] [evidence IEA] axon guidance [goid 7411] [pmid 9143507] [evidence NAS] structural molecule activity [goid 5198] [evidence IEA] NM_006181.1
ILMN_1715540 Homo sapiens RefSeq ILMN_2384 ILMN_2384 TRAIP NM_005879.2 NM_005879.2 10293 40807468 NM_005879.2 TRAIP NP_005870.2 7380347 S 1609 TCGGGACCAGCCTGAGGTGTAAGGGCAGACAAACAGGTGAGGGTGAGTGT 3 - 49841397-49841446 3p21.31c Homo sapiens TRAF interacting protein (TRAIP), mRNA. cell proliferation [goid 8283] [pmid 9104814] [evidence TAS]; induction of apoptosis [goid 6917] [pmid 9104814] [evidence TAS]; signal transduction [goid 7165] [pmid 9104814] [evidence TAS] metal ion binding [goid 46872] [evidence IEA]; zinc ion binding [goid 8270] [evidence IEA]; protein binding [goid 5515] [evidence IEA] TRIP; RNF206 NM_005879.2
ILMN_2371280 Homo sapiens RefSeq ILMN_21047 ILMN_21047 CSF3R NM_172313.1 NM_172313.1 1441 27437044 NM_172313.1 CSF3R NP_758519.1 6270114 A 2459 GACCAGATCATGCTCCATCCAGCCCCACCCAATGGCCTTTTGTGCTTGTT 1 - 36704305-36704354 1p34.3d Homo sapiens colony stimulating factor 3 receptor (granulocyte) (CSF3R), transcript variant 4, mRNA. integral to plasma membrane [goid 5887] [pmid 7542747] [evidence TAS]; membrane [goid 16020] [evidence IEA] cell adhesion [goid 7155] [evidence IEA]; defense response [goid 6952] [pmid 7542747] [evidence TAS]; signal transduction [goid 7165] [pmid 1371413] [evidence NAS] receptor activity [goid 4872] [pmid 7542747] [evidence TAS]; hematopoietin/interferon-class (D200-domain) cytokine receptor activity [goid 4896] [evidence IEA]; protein binding [goid 5515] [evidence IEA] GCSFR; CD114 NM_172313.1
ILMN_1777550 Homo sapiens RefSeq ILMN_25863 ILMN_25863 ARL13A NM_001012990.1 NM_001012990.1 392509 61175259 NM_001012990.1 ARL13A NP_001013008.1 4730291 S 678 GCCAACTACCACCTACCTCGAGCATCTCAATCTCCAAGAATAACACAGGC X + 100129126-100129175 Xq22.1c Homo sapiens ADP-ribosylation factor-like 13A (ARL13A), mRNA. nucleotide binding [goid 166] [evidence IEA]; GTP binding [goid 5525] [evidence IEA] dJ341D10.2; ARL13 NM_001012990.1
ILMN_1788239 Homo sapiens RefSeq ILMN_26806 ILMN_26806 AMDHD1 NM_152435.1 NM_152435.1 144193 22748912 NM_152435.1 AMDHD1 NP_689648.1 6520112 S 1951 GCTTCCCAGCAGCGTTCAAGACACATCATTTATACACAGGCACAGGGGCC 12 + 94886316-94886365 12q23.1a Homo sapiens amidohydrolase domain containing 1 (AMDHD1), mRNA. cytoplasm [goid 5737] [evidence IEA] histidine catabolism to glutamate and formamide [goid 19556] [evidence IEA] hydrolase activity [goid 16787] [evidence IEA] MGC35366; HMFT1272 NM_152435.1
ILMN_2148679 Homo sapiens RefSeq ILMN_175112 ILMN_175112 SDHAP3 NR_003263.1 NR_003263.1 728609 118130933 NR_003263.1 SDHAP3 6350341 S 14386 CGGGGATGTTTAGCTTGAATTGCACCTCTCAGTCTGTGTGCCACGGCCCC 5p15.33d Homo sapiens succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 3 (SDHAP3) on chromosome 5. SDHAL; SDHACL NR_003263.1
ILMN_1656792 Homo sapiens RefSeq ILMN_18604 ILMN_18604 FLYWCH1 NM_020912.1 NM_020912.1 84256 62953135 NM_020912.1 FLYWCH1 NP_065963.1 1450445 A 2380 CTCCCCACCACGGCCCAGCAGGAGGACCCAGAAAAGATTCAAGTTCAGCT 16 + 2928428-2928458:2930034-2930052 16p13.3d Homo sapiens FLYWCH-type zinc finger 1 (FLYWCH1), transcript variant 2, mRNA. NM_020912.1
ILMN_1803590 Homo sapiens RefSeq ILMN_139272 ILMN_139272 PSRC2 NM_144982.3 NM_144982.3 196441 34787414 NM_144982.3 PSRC2 NP_659419.2 3940451 S 7047 CGGTTGGATAAATGAACTTCCTGTTTGGCCTGCTTCTAGGCCCTGCCAGA 12 - 70290245-70290294 12q21.1a Homo sapiens proline/serine-rich coiled-coil 2 (PSRC2), mRNA. nucleus [goid 5634] [evidence IEA] RNA processing [goid 6396] [evidence IEA] binding [goid 5488] [evidence IEA] MGC90200; KIAA0546; MGC23401; DKFZp686A0722 NM_144982.3
ILMN_1730765 Homo sapiens RefSeq ILMN_15436 ILMN_15436 DUSP22 NM_020185.3 NM_020185.3 56940 34147625 NM_020185.3 DUSP22 NP_064570.1 610072 I 560 GCCAGGCCTATGTTGGAGGGAGTTAAATACCTGTGCATCCCAGCAGCGGA 6 + 256945-256962:280114-280145 6p25.3b Homo sapiens dual specificity phosphatase 22 (DUSP22), mRNA. nucleus [goid 5634] [evidence IEA]; nucleus [goid 5634] [evidence IEA] apoptosis [goid 6915] [pmid 9205128] [evidence TAS]; cell proliferation [goid 8283] [pmid 9205128] [evidence TAS]; inactivation of MAPK activity [goid 188] [pmid 9205128] [evidence TAS]; development [goid 7275] [pmid 9205128] [evidence TAS]; protein amino acid dephosphorylation [goid 6470] [pmid 9205128] [evidence TAS]; apoptosis [goid 6915] [pmid 9205128] [evidence TAS]; cell proliferation [goid 8283] [pmid 9205128] [evidence TAS]; inactivation of MAPK activity [goid 188] [pmid 9205128] [evidence TAS]; development [goid 7275] [pmid 9205128] [evidence TAS]; protein amino acid dephosphorylation [goid 6470] [pmid 9205128] [evidence TAS] hydrolase activity [goid 16787] [evidence IEA]; protein tyrosine phosphatase activity [goid 4725] [evidence IEA]; protein tyrosine/serine/threonine phosphatase activity [goid 8138] [evidence IEA]; hydrolase activity [goid 16787] [evidence IEA]; protein tyrosine phosphatase activity [goid 4725] [evidence IEA]; protein tyrosine/serine/threonine phosphatase activity [goid 8138] [evidence IEA] MKPX; VHX; JSP1; JKAP NM_020185.3
ILMN_1671809 Homo sapiens RefSeq ILMN_15436 ILMN_15436 DUSP22 NM_020185.3 NM_020185.3 56940 34147625 NM_020185.3 DUSP22 NP_064570.1 3710626 A 1181 TTCCCCTTATCCCCACTGCTGTGGAGGTTTCTGTACCTCGCTTGGATGCC 6 + 296055-296104 6p25.3b Homo sapiens dual specificity phosphatase 22 (DUSP22), mRNA. nucleus [goid 5634] [evidence IEA]; nucleus [goid 5634] [evidence IEA] apoptosis [goid 6915] [pmid 9205128] [evidence TAS]; cell proliferation [goid 8283] [pmid 9205128] [evidence TAS]; inactivation of MAPK activity [goid 188] [pmid 9205128] [evidence TAS]; development [goid 7275] [pmid 9205128] [evidence TAS]; protein amino acid dephosphorylation [goid 6470] [pmid 9205128] [evidence TAS]; apoptosis [goid 6915] [pmid 9205128] [evidence TAS]; cell proliferation [goid 8283] [pmid 9205128] [evidence TAS]; inactivation of MAPK activity [goid 188] [pmid 9205128] [evidence TAS]; development [goid 7275] [pmid 9205128] [evidence TAS]; protein amino acid dephosphorylation [goid 6470] [pmid 9205128] [evidence TAS] hydrolase activity [goid 16787] [evidence IEA]; protein tyrosine phosphatase activity [goid 4725] [evidence IEA]; protein tyrosine/serine/threonine phosphatase activity [goid 8138] [evidence IEA]; hydrolase activity [goid 16787] [evidence IEA]; protein tyrosine phosphatase activity [goid 4725] [evidence IEA]; protein tyrosine/serine/threonine phosphatase activity [goid 8138] [evidence IEA] MKPX; VHX; JSP1; JKAP NM_020185.3
ILMN_1750625 Homo sapiens RefSeq ILMN_137331 ILMN_137331 RSPO4 NM_001029871.1 NM_001029871.1 343637 71274173 NM_001029871.1 RSPO4 NP_001025042.1 3870014 S 2804 ATATTACATTCCCGACCCCAAGAGAGCACCCACCCTCAGACCTGCCCTCC 20 - 887328-887377 20p13e Homo sapiens R-spondin family, member 4 (RSPO4), mRNA. electron transport [goid 6118] [evidence IEA] electron transporter activity [goid 5489] [evidence IEA]; iron ion binding [goid 5506] [evidence IEA] dJ824F16.3; C20orf182; FLJ16018 NM_001029871.1
ILMN_1689814 Homo sapiens RefSeq ILMN_11679 ILMN_11679 DUSP13 NM_016364.3 NM_016364.3 51207 56237017 NM_016364.3 DUSP13 NP_057448.3 6220279 I 9 AGAGTCCTGCCCCTGCACCCACTCCCCCATTCCCGGCCCCAGGCCATGCC 10 - 76529196-76529245 10q22.2c Homo sapiens dual specificity phosphatase 13 (DUSP13), transcript variant 6, mRNA. meiosis [goid 7126] [pmid 10585869] [evidence TAS]; protein amino acid dephosphorylation [goid 6470] [pmid 10585869] [evidence TAS]; spermatogenesis [goid 7283] [pmid 10585869] [evidence TAS] hydrolase activity [goid 16787] [evidence IEA]; protein tyrosine phosphatase activity [goid 4725] [evidence IEA]; protein tyrosine/serine/threonine phosphatase activity [goid 8138] [pmid 10585869] [evidence TAS] DUSP13A; TMDP; SKRP4; BEDP; MDSP; FLJ32450; DUSP13B NM_016364.3

Total number of rows: 24526

Table truncated, full table size 16376 Kbytes.

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6883_HumanRef-8_V3_0_R0_11282963_A.bgx.gz 3.9 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap