NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6887 Query DataSets for GPL6887
Status Public on May 21, 2008
Title Illumina MouseWG-6 v2.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Mus musculus
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The MouseWG-6 v2.0 Expression BeadChip offer the most up-to-date content for whole-genome expression profiling in the mouse. Featuring content derived from the National Center for Biotechnology Information Reference Sequence (NCBI RefSeq) database (Build 36, Release 22).

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/projects/geo/info/spreadsheet.html

August 31, 2012: annotation table updated with MouseWG-6_V2_0_R3_11278593_A.txt
 
Submission date May 21, 2008
Last update date Jan 16, 2019
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (17084) GSM370393, GSM370394, GSM370395, GSM370396, GSM370397, GSM370398 
Series (1215)
GSE14800 Lasp1 gene disruption is linked to enhanced cell migration and tumor formation
GSE14813 Lasp1 gene deletion: Effect on gene expression in the gastric mucosa
GSE15476 Comparisons between liver tissues and freshly isolated hepatocytes from IkkβF/F and IkkβDhep (Ikkβ-deleted) mice
Relations
Alternative to GPL9526 (Alternative CDF)
Alternative to GPL10951
Alternative to GPL13824
Alternative to GPL17473
Alternative to GPL18752 (gene symbol version)
Alternative to GPL19625 (MouseWG-6_V2_0_R1_11278593_A version)
Alternative to GPL19738 (MouseWG-6_V2_0_R1_11278593_A; Gene Symbol version)
Alternative to GPL21278 (Probe ID version)

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Probe_Id
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
Probe_Sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome built
Cytoband
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
Obsolete_Probe_Id Identifier of probe id before bgx time
GB_ACC
ORF

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Probe_Id Array_Address_Id Probe_Type Probe_Start Probe_Sequence Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id GB_ACC ORF
ILMN_1243094 Mus musculus Riken ILMN_204164 ILMN_204164 THRSP ri|C730035M01|PX00087M15|AK050300|1404 AK050300 Thrsp ILMN_1243094 2600193 S 1127 GCCCTGCCTGACCTGGAAACGTAGAGATTCTTCTGCCTCAGGTTCCAGAG A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] AK050300 THRSP
ILMN_1238674 Mus musculus RefSeq ILMN_188674 ILMN_245303 2700007P21RIK NM_173750.2 NM_173750.2 212772 68299772 NM_173750.2 2700007P21Rik NP_776111.1 ILMN_1238674 3450193 S 1291 CCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTTTAGGC 2 - 106804608-106804657 2qE3 Mus musculus RIKEN cDNA 2700007P21 gene (2700007P21Rik), transcript variant 2, mRNA. 4930448O08Rik; RP23-12N7.2 4930448O08Rik; RP23-12N7.2 NM_173750.2 2700007P21RIK
ILMN_2454720 Mus musculus RefSeq ILMN_188674 ILMN_245303 2700007P21RIK NM_173750.2 NM_173750.2 212772 68299772 NM_173750.2 2700007P21Rik NP_776111.1 ILMN_2454720 1710328 S 3100 AAACATACCGTAGAGTTTATAGACAAAAGTATATCTGATCTTGAGTAAAC 2 - 106802799-106802848 2qE3 Mus musculus RIKEN cDNA 2700007P21 gene (2700007P21Rik), transcript variant 2, mRNA. 4930448O08Rik; RP23-12N7.2 4930448O08Rik; RP23-12N7.2 NM_173750.2 2700007P21RIK
ILMN_3062534 Mus musculus RefSeq ILMN_245303 ILMN_245303 2700007P21RIK NM_173750.2 NM_173750.2 212772 68299772 NM_173750.2 2700007P21Rik NP_776111.1 ILMN_3062534 1570300 I 20 CAGTGGGATGATTCCCTATGTCTGGAGGTAGAAGATGGTTGTGGTATGGC 2 - 106810479-106810528 2qE3 Mus musculus RIKEN cDNA 2700007P21 gene (2700007P21Rik), transcript variant 2, mRNA. 4930448O08Rik; RP23-12N7.2 4930448O08Rik; RP23-12N7.2 NM_173750.2 2700007P21RIK
ILMN_3140158 Mus musculus RefSeq ILMN_245303 ILMN_245303 2700007P21RIK NM_173750.2 NM_173750.2 212772 68299772 NM_173750.2 2700007P21Rik NP_776111.1 ILMN_3140158 2690168 A 2842 GACCTCTGCAGGCTTCGCACCACAGCCTTTTCACGCTGGGCAACATGCAT 2 - 106803057-106803106 2qE3 Mus musculus RIKEN cDNA 2700007P21 gene (2700007P21Rik), transcript variant 2, mRNA. 4930448O08Rik; RP23-12N7.2 4930448O08Rik; RP23-12N7.2 NM_173750.2 2700007P21RIK
ILMN_1240307 Mus musculus RefSeq ILMN_198854 ILMN_198854 LOC233991 XM_146216.2 XM_146216.2 38089106 XM_146216.2 LOC233991 ILMN_1240307 2370397 S 3 GCTGGTGAGAGAACTGGAGGCCATAAAAGAAGATGGAATCATGGATGCTG XM_146216.2 LOC233991
ILMN_1251139 Mus musculus RefSeq ILMN_184509 ILMN_245410 DENND4C NM_001081014.1 NM_001081014.1 329877 124486609 NM_001081014.1 Dennd4c NP_001074483.1 ILMN_1251139 2900470 S 3186 TGGGGAGCACACAGTCTTCGTCAGAGACTTAATCAGCCTTGATTCCATTG 4 + 86459765-86459814 4qC4 Mus musculus DENN/MADD domain containing 4C (Dennd4c), mRNA. RP24-468M3.1; 1700065A05Rik; AA420392 RP24-468M3.1; 1700065A05Rik; AA420392 NM_001081014.1 DENND4C
ILMN_2935307 Mus musculus RefSeq ILMN_245410 ILMN_245410 DENND4C NM_001081014.1 NM_001081014.1 329877 124486609 NM_001081014.1 Dennd4c NP_001074483.1 ILMN_2935307 730253 S 568 GAAGCCACTCCATCAGCACTCCAAGCAAACTTGAATTATGGAAGTCTGAA 4 + 86420351-86420400 4qC4 Mus musculus DENN/MADD domain containing 4C (Dennd4c), mRNA. RP24-468M3.1; 1700065A05Rik; AA420392 RP24-468M3.1; 1700065A05Rik; AA420392 NM_001081014.1 DENND4C
ILMN_2429159 Mus musculus MEEBO ILMN_185688 ILMN_185688 LOXHD1 scl51741.10.113_85 Loxhd1 ILMN_2429159 5860035 S 7 GGTAGTGGACATGGGGTCTCATATCCGCCAGAGGCTGCTCCTTGCAAGTG LOXHD1
ILMN_2754227 Mus musculus MEEBO ILMN_192283 ILMN_192283 PRPF31 scl33145.14_332 31980641 NM_027328 Prpf31 ILMN_2754227 7150546 S 2017 ACACCATCACCTGCCCCATGAGAACATCAGCATCATGGCCACCACAAAAC A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]; A ribonucleoprotein complex, containing RNA and small nuclear ribonucleoproteins (snRNPs) that is assembled during the splicing of messenger RNA primary transcript to excise an intron [goid 5681] [evidence IEA]; A discrete extra-nucleolar subnuclear domain, 20-50 in number, in which splicing factors are seen to be localized by immunofluorescence microscopy [goid 16607] [evidence ISA]; A class of nuclear body, first seen after silver staining by Cajal in 1903, enriched in small nuclear ribonucleoproteins, and certain general RNA polymerase II transcription factors; ultrastructurally, they appear as a tangle of coiled, electron-dense threads roughly 0.5 micrometers in diameter; involved in aspects of snRNP biogenesis; the protein coilin serves as a marker for Cajal bodies. Some argue that Cajal bodies are the sites for preassembly of transcriptosomes, unitary particles involved in transcription and processing of RNA [goid 15030] [evidence ISA]; A complex composed of three small nuclear ribonucleoproteins, snRNP U4, snRNP U6 and snRNP U5 [goid 46540] [evidence ISA] The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA]; Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The formation of a tri-snRNP complex containing U4 and U6 (or U4atac and U6atac) snRNAs and U5 snRNAs and associated proteins. This includes reannealing of U4 and U6 (or U4atac and U6atac) snRNAs released from previous rounds of splicing to reform the U4/U6 snRNP (or U4atac/U6atac snRNP) as well as the subsequent association of the U5 snRNP with the U4/U6 snRNP (or U4atac/U6atac snRNP) to form a tri-snRNP that is ready to reassemble into another spliceosome complex [goid 244] [evidence ISA]; The joining together of exons from one or more primary transcripts of nuclear messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced [goid 398] [evidence ISA] Interacting selectively with any complex of RNA and protein [goid 43021] [evidence ISA]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [evidence ISA] NM_027328 PRPF31
ILMN_1225693 Mus musculus RefSeq ILMN_201003 ILMN_310186 LOC100039693 XM_001473202.1 XM_001473202.1 100039693 149272784 XM_001473202.1 LOC100039693 XP_001473252.1 ILMN_1225693 1690601 S 324 CCAGGCTCTGGGGAATAAGGTTGGCTGCAGAATTTCTCACGGTTGGAAGG Y|NT_161902.3 - 705148-705197 PREDICTED: Mus musculus hypothetical protein LOC100039693 (LOC100039693), mRNA. XM_001473202.1 LOC100039693
ILMN_1234015 Mus musculus RefSeq ILMN_200541 ILMN_310186 LOC100039693 XM_001473202.1 XM_001473202.1 100039693 149272784 XM_001473202.1 LOC100039693 XP_001473252.1 ILMN_1234015 1170100 S 606 TGAGAGGAAACATGGCTCTGAGAAAAACTGGAGTGGGATGGTGCTAGCCC Y|NT_161902.3 - 704866-704915 PREDICTED: Mus musculus hypothetical protein LOC100039693 (LOC100039693), mRNA. XM_001473202.1 LOC100039693
ILMN_2603725 Mus musculus RefSeq ILMN_210252 ILMN_210252 ARPC3 NM_019824.3 NM_019824.3 56378 142361460 NM_019824.3 Arpc3 NP_062798.1 ILMN_2603725 3710242 S 469 GCTGAGGCAAGAGACCGGACTGAGGCTGTGTGAGAAGGTTTTTGACCCTC 5 + 122855118-122855167 5qF Mus musculus actin related protein 2/3 complex, subunit 3 (Arpc3), mRNA. All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA]; A prolongation or process extending from a cell, e.g. a flagellum or axon [goid 42995] [evidence IEA]; A thin sheetlike process extended by the leading edge of a crawling fibroblast; contains a dense meshwork of actin filaments [goid 30027] [evidence IDA]; Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles [goid 5856] [evidence IEA]; A stable protein complex that contains two actin-related proteins, Arp2 and Arp3, and five novel proteins (ARPC1-5), and functions in the nucleation of branched actin filaments [goid 5885] [evidence TAS] Any process that modulates the frequency, rate or extent of the assembly of actin filaments by the addition of actin monomers to a filament [goid 30833] [evidence IEA] Interacting selectively with monomeric or multimeric forms of actin, including actin filaments [goid 3779] [evidence IEA] p21Arc; p21-Ar; 1110006A04Rik; AI788639; AA408672; 21kDa p21Arc; p21-Ar; 1110006A04Rik; AI788639; AA408672; 21kDa NM_019824.3 ARPC3
ILMN_2664884 Mus musculus RefSeq ILMN_208788 ILMN_208788 TSPAN17 NM_028841.2 NM_028841.2 74257 142386321 NM_028841.2 Tspan17 NP_083117.1 ILMN_2664884 2810273 S 286 ACATCTCGGCGCTGACAGATCTGGGCGGTCTTGACCCCGTGTGGCTGTTT 13 + 54894114-54894163 13qB1 Mus musculus tetraspanin 17 (Tspan17), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 2210021G21Rik; Tm4sf17; Fbxo23; AI047581 2210021G21Rik; Tm4sf17; Fbxo23; AI047581 NM_028841.2 TSPAN17
ILMN_1229397 Mus musculus RefSeq ILMN_208829 ILMN_208829 SLC1A1 NM_009199.2 NM_009199.2 20510 118130482 NM_009199.2 Slc1a1 NP_033225.1 ILMN_1229397 840242 S 2256 CAATGTACTGTATTGAGACACTGGTAGCTGACAGCCAGTGTTCGGTATAG 19 + 28986998-28987047 19qC1 Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA. XM_001002173 XM_001002184 XM_001002198 XM_001002207 Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] The directed movement of substances (such as macromolecules, small molecules, ions) into, out of, within or between cells, or within a multicellular organism [goid 6810] [evidence IEA]; The directed movement of dicarboxylic acids into, out of, within or between cells [goid 6835] [evidence IEA] Enables the active transport of a solute across a membrane by a mechanism whereby two or more species are transported together in the same direction in a tightly coupled process not directly linked to a form of energy other than chemiosmotic energy [goid 15293] [evidence IEA]; Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: dicarboxylate(out) + Na+(out) = dicarboxylate(in) + Na+(in) [goid 17153] [evidence IEA]; Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: glutamate(out) + Na+(out) = glutamate(in) + Na+(in) [goid 15501] [evidence IDA] MEAAC1; EAAC2; EAAC1; EAAT3; D130048G10Rik MEAAC1; EAAC2; EAAC1; EAAT3; D130048G10Rik NM_009199.2 SLC1A1
ILMN_1225873 Mus musculus RefSeq ILMN_208829 ILMN_208829 SLC1A1 NM_009199.2 NM_009199.2 20510 118130482 NM_009199.2 Slc1a1 NP_033225.1 ILMN_1225873 5870100 S 3552 CAGGTGGTTCTCCTTAGTGGCAGTGAATTGGCAGAGCCGTTCACAAGATC 19 + 28988294-28988343 19qC1 Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA. XM_001002173 XM_001002184 XM_001002198 XM_001002207 Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] The directed movement of substances (such as macromolecules, small molecules, ions) into, out of, within or between cells, or within a multicellular organism [goid 6810] [evidence IEA]; The directed movement of dicarboxylic acids into, out of, within or between cells [goid 6835] [evidence IEA] Enables the active transport of a solute across a membrane by a mechanism whereby two or more species are transported together in the same direction in a tightly coupled process not directly linked to a form of energy other than chemiosmotic energy [goid 15293] [evidence IEA]; Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: dicarboxylate(out) + Na+(out) = dicarboxylate(in) + Na+(in) [goid 17153] [evidence IEA]; Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: glutamate(out) + Na+(out) = glutamate(in) + Na+(in) [goid 15501] [evidence IDA] MEAAC1; EAAC2; EAAC1; EAAT3; D130048G10Rik MEAAC1; EAAC2; EAAC1; EAAT3; D130048G10Rik NM_009199.2 SLC1A1
ILMN_3003575 Mus musculus RefSeq ILMN_217309 ILMN_217309 CNDP1 NM_177450.2 NM_177450.2 338403 31343343 NM_177450.2 Cndp1 NP_803233.1 ILMN_3003575 6860768 S 2010 GTTCACTTTCCAGTCCCAAGAACTGTGGTTCCCAATCATCGGACCCAGGG 18 - 84745460-84745509 18qE4 Mus musculus carnosine dipeptidase 1 (metallopeptidase M20 family) (Cndp1), mRNA. That part of the cytoplasm that does not contain membranous or particulate subcellular components [goid 5829] [evidence ISO] The hydrolysis of a peptide bond or bonds within a protein [goid 6508] [evidence ISO] Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the hydrolysis of the terminal or penultimate peptide bond at the C-terminal end of a peptide or polypeptide [goid 4180] [evidence IEA]; Interacting selectively with zinc (Zn) ions [goid 8270] [evidence IEA]; Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid [goid 8233] [evidence IEA]; Interacting selectively with any metal ion [goid 46872] [evidence IEA]; Catalysis of the hydrolysis of peptide bonds by a mechanism in which water acts as a nucleophile, one or two metal ions hold the water molecule in place, and charged amino acid side chains are ligands for the metal ions [goid 8237] [evidence IEA]; The formation of a protein dimer, a macromolecular structure consists of two noncovalently associated identical or nonidentical subunits [goid 46983] [evidence IEA]; Catalysis of the hydrolysis of a dipeptide [goid 16805] [evidence ISO] AI746433; Cn1 AI746433; Cn1 NM_177450.2 CNDP1
ILMN_1257702 Mus musculus RefSeq ILMN_189767 ILMN_234717 LARS NM_134137.2 NM_134137.2 107045 120537240 NM_134137.2 Lars NP_598898.2 ILMN_1257702 3390102 S 3664 GGGATGGTTTTCGGATACTTCTGCTCCGAGAATCTCAAGCTGGCTCTAAC 18 - 42362095-42362144 18qB3 Mus musculus leucyl-tRNA synthetase (Lars), mRNA. XM_901187 XM_913429 XM_922755 XM_922767 XM_922771 XM_922775 XM_922782 XM_922785 XM_989215 All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA] The chemical reactions and pathways resulting in the formation of a protein. This is a ribosome-mediated process in which the information in messenger RNA (mRNA) is used to specify the sequence of amino acids in the protein [goid 6412] [evidence IEA]; The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis [goid 6418] [evidence IEA]; The process of coupling leucine to leucyl-tRNA, catalyzed by leucyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA [goid 6429] [evidence IEA] Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of pyrophosphate and AMP [goid 4812] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Catalysis of the ligation of two substances with concomitant breaking of a diphosphate linkage, usually in a nucleoside triphosphate. Ligase is the systematic name for any enzyme of EC class 6 [goid 16874] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Catalysis of the reaction: ATP + L-leucine + tRNA(Leu) = AMP + diphosphate + L-leucyl-tRNA(Leu) [goid 4823] [evidence IEA] 3110009L02Rik; mKIAA1352; AW536573; 2310045K21Rik 3110009L02Rik; mKIAA1352; AW536573; 2310045K21Rik NM_134137.2 LARS
ILMN_2899591 Mus musculus RefSeq ILMN_234717 ILMN_234717 LARS NM_134137.2 NM_134137.2 107045 120537240 NM_134137.2 Lars NP_598898.2 ILMN_2899591 3190327 S 3347 GGCACTTCTCCACCAAAATCGACATCAGGCAAGGAGATAGCTGTGAGTCC 18 - 42369713-42369762 18qB3 Mus musculus leucyl-tRNA synthetase (Lars), mRNA. XM_901187 XM_913429 XM_922755 XM_922767 XM_922771 XM_922775 XM_922782 XM_922785 XM_989215 All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA] The chemical reactions and pathways resulting in the formation of a protein. This is a ribosome-mediated process in which the information in messenger RNA (mRNA) is used to specify the sequence of amino acids in the protein [goid 6412] [evidence IEA]; The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis [goid 6418] [evidence IEA]; The process of coupling leucine to leucyl-tRNA, catalyzed by leucyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA [goid 6429] [evidence IEA] Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of pyrophosphate and AMP [goid 4812] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Catalysis of the ligation of two substances with concomitant breaking of a diphosphate linkage, usually in a nucleoside triphosphate. Ligase is the systematic name for any enzyme of EC class 6 [goid 16874] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Catalysis of the reaction: ATP + L-leucine + tRNA(Leu) = AMP + diphosphate + L-leucyl-tRNA(Leu) [goid 4823] [evidence IEA] 3110009L02Rik; mKIAA1352; AW536573; 2310045K21Rik 3110009L02Rik; mKIAA1352; AW536573; 2310045K21Rik NM_134137.2 LARS
ILMN_2658355 Mus musculus RefSeq ILMN_215341 ILMN_215341 UGT3A2 NM_144845.3 NM_144845.3 223337 142365155 NM_144845.3 Ugt3a2 NP_659094.1 ILMN_2658355 520358 S 1782 CTGATGCACCCGAGTTAGTACCTCACTACTTTTGGCCCTGTTTTCCTCTT 15 + 9300211-9300260 15qA1 Mus musculus UDP glycosyltransferases 3 family, polypeptide A2 (Ugt3a2), mRNA. Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA] The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA] Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2 [goid 16740] [evidence IEA]; Catalysis of the transfer of a glycosyl group from one compound (donor) to another (acceptor) [goid 16757] [evidence IEA]; Catalysis of the transfer of a hexosyl group from one compound (donor) to another (acceptor) [goid 16758] [evidence IEA]; Catalysis of the reaction: UDP-glucuronate + acceptor = UDP + acceptor beta-D-glucuronoside [goid 15020] [evidence IEA] MGC37820; AI313915 MGC37820; AI313915 NM_144845.3 UGT3A2

Total number of rows: 45281

Table truncated, full table size 63285 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6887_MouseWG-6_V2_0_R0_11278593_A.bgx.gz 4.5 Mb (ftp)(http) BGX
GPL6887_MouseWG-6_V2_0_R3_11278593_A.txt.gz 11.3 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap