NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7723 Query DataSets for GPL7723
Status Public on Dec 19, 2008
Title miRCURY LNA microRNA Array, v.11.0 - hsa, mmu & rno
Technology type spotted oligonucleotide
Distribution commercial
Organisms Homo sapiens; Mus musculus; Rattus norvegicus; Human alphaherpesvirus 1; Human betaherpesvirus 5; Murid betaherpesvirus 1; Human gammaherpesvirus 4; JC polyomavirus; Human immunodeficiency virus 1; Murid gammaherpesvirus 4; Human gammaherpesvirus 8; Human polyomavirus 1; Macaca mulatta polyomavirus 1
Manufacturer Exiqon A/S
Manufacture protocol See manufacturers website
Catalog number 208200-A,208201-A,208202-A
Support Glass
 
Description Array covering Sanger miRBase 12.0 and Exiqon miRPlus mature miRNAs.
The platform information provided is from the time of the design.
Names, accession numbers and sequences are listed for mature miRNAs in miRBase 12.0. Some probes may target multiple miRNAs, in which case multiple miRNA names, accession numbers and sequences are listed separated by '/'
 
Web link http://www.exiqon.com/SEEEMS/26.asp
Submission date Dec 02, 2008
Last update date May 10, 2016
Contact name Exiqon A/S
E-mail(s) support@exiqon.com
Phone +4545660888
Fax +4545661888
URL http://www.exiqon.com
Organization name Exiqon A/S
Street address Bygstubben 9
City Vedbaek
ZIP/Postal code 2950
Country Denmark
 
Samples (575) GSM399626, GSM399628, GSM399629, GSM399630, GSM399631, GSM399632 
Series (58)
GSE15925 Mature thymic NKT and T cells
GSE18782 MicroRNA expression profiling in adult mouse liver following benzo(a)pyrene (BaP) treatment [Exiqon miRNA array]
GSE18841 Adult mouse liver following benzo(a)pyrene (BaP) treatment: miRNA and mRNa profiling

Data table header descriptions
ID ID of probe
miRNA_ID_LIST Name of targeted mature miRNA in Homo sapiens, Mus musculus, Rattus norvegicus, Epstein-barr virus, Human herpesvirus 5, Human immunodeficiency virus 1, Human herpesvirus 1, Human herpesvirus 8, Murid herpesvirus 1, Murid herpesvirus 4, Simian virus 40, BK polyomavirus, JC polyomavirus
Accession Sanger miRBase accession number
SEQUENCE Sequence if targeting a miR in organism and miRBase 12.0
Database miRBase 12.0
SPOT_ID

Data table
ID miRNA_ID_LIST Accession SEQUENCE Database SPOT_ID
11279 U6-snRNA-2
11278 U6-snRNA-1
46207 U6B-5
46209 U6B-3
17492 sv40-miR-S1-5p MIMAT0003344 UGAGGGGCCUGAAAUGAGCCUU miRBase 12.0
17614 sv40-miR-S1-3p MIMAT0003345 GCCUGUUUCAUGCCCUGAGU miRBase 12.0
10899 spike_control_j
14257 spike_control_i
10907 spike_control_h
10905 spike_control_g
14262 spike_control_f
10906 spike_control_e
10904 spike_control_d
14264 spike_control_c
14263 spike_control_b
14261 spike_control_a
46197 SNORD66-5
46198 SNORD66-3
46203 SNORD49A-5
46199 SNORD49A-3

Total number of rows: 2003

Table truncated, full table size 125 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap