NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8786 Query DataSets for GPL8786
Status Public on Jul 01, 2009
Title [miRNA-1] Affymetrix Multispecies miRNA-1 Array
Technology type in situ oligonucleotide
Distribution commercial
Organism synthetic construct
Manufacturer Affymetrix
Manufacture protocol see manufacturer's web site
 
Description Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://0-www.ncbi.nlm.nih.gov.brum.beds.ac.uk/projects/geo/info/geo_affy.html

#%create_date=Tue Oct 21 17:29:14 PDT 2008
#%guid=0000050091-1224635354-0064538561-0684514888-1962062125
#%chip_type=miRNA-1_0
# File contains all miRNAs from miRBase that have mapping information grouped by organism, all miRNAs without mapping information grouped by organism (designated as Sequence Type: miRNA), all sno/sca from UCSC (snoRNABase) and Ensembl (designated as Sequence Type: CDBox, HAcaBox, snoRNA and scaRna, and controls).
# miRNAs:
# * An annot name generally represents one genome location, but may refer to multiple annotations because of multiple mature products delineated by "-3p" and "-5p", or ".1" and ".2".
# * Also, those with a '-star' are minor products, and those without '-star' or any other aforementioned suffix are considered the major product.
# * Probeset IDs may appear more than once because the miRNA was mapped to multiple locations in the genome, and the annot names may have a "-1", "-2", etc type of suffix.
# * Probeset IDs with a letter suffix (eg, fru-miR-23a and fru-miR-23b) are related miRNAs where the sequence is highly similar.
# sno/sca:
# * The sequences for the sno/sca probesets are the entire sequences sent to Chip Design, not just the SIF regions.

 
Web link http://www.affymetrix.com/products_services/arrays/specific/mi_rna.affx#1_1
http://www.affymetrix.com/analysis/index.affx
Submission date Jul 01, 2009
Last update date May 02, 2017
Organization Affymetrix, Inc.
E-mail(s) geo@ncbi.nlm.nih.gov, support@affymetrix.com
Phone 888-362-2447
URL http://www.affymetrix.com/index.affx
Street address
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
 
Samples (4415) GSM475556, GSM475557, GSM475558, GSM475559, GSM475560, GSM475561 
Series (200)
GSE19183 miRNA profiling of FACS sorted human leukocyte cell types
GSE23022 MicroRNA expression data from human prostate cancer
GSE24066 miRNA profiling during cardiomyocyte-specific differentiation of murine embryonic stem cells based on two different miRNA array platforms

Data table header descriptions
ID Affymetrix Probe Set ID
miRNA_ID_LIST miRNA name
SPOT_ID
Species Scientific Name The genus and species of the organism represented by the probe set.
Annotation Date The date that the annotations for this probe array were last updated. It will generally be earlier than the date when the annotations were posted on the Affymetrix web site.
Sequence Type Indicates whether the sequence is an Exemplar, Consensus or Control sequence. An Exemplar is a single nucleotide sequence taken directly from a public database. This sequence could be an mRNA or EST. A Consensus sequence, is a nucleotide sequence assembled by Affymetrix, based on one or more sequence taken from a public database.
Sequence Source The database from which the sequence used to design this probe set was taken.
Transcript ID(Array Design)
Alignments Position of the alignment of the target sequence on the genome. Format: "chromosome // start-end // strand // percentage identity"
Sequence Length
SEQUENCE target sequence

Data table
ID miRNA_ID_LIST SPOT_ID Species Scientific Name Annotation Date Sequence Type Sequence Source Transcript ID(Array Design) Alignments Sequence Length SEQUENCE
14q-0_st CDBox: 14q(0) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(0) chr14:100434010-100434086 (+) 77 TGGACCAATGATGAGACAGTGTTTATGAACAAAAGATCATGATTAATCCAGTTCTGCACAAAACACTGAGGTCCATT
14qI-1_st CDBox: 14q(I-1) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-1) chr14:100460911-100460980 (+) 70 AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCC
14qI-2_st CDBox: 14q(I-2) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-2) chr14:100463432-100463502 (+) 71 ATAGCCAATCATTAGTATTCTGAGCTGTAGGAATCAAAGATTTTGATTAGATTCTGTAACTCAGAGGTTTA
14qI-3_x_st CDBox: 14q(I-3) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-3) chr14:100466009-100466079 (+) 71 TAGACCAATGATGAGTATTCTGGGGTGTCTGAATCAATGATTTTGATTAAACCCTGTAACTCTGAGGTCCA
14qI-4_st CDBox: 14q(I-4) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-4) chr14:100472581-100472654 (+) 74 TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA
14qI-4_x_st CDBox: 14q(I-4) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-4) chr14:100472581-100472654 (+) 74 TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA
14qI-5_st CDBox: 14q(I-5) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-5) chr14:100474277-100474353 (+) 77 TGGATCAATGATGAGTATTGGTGGAGGTGTCTGAATCAACACTTTTGATTAAGCCCTCTGTGTAACTCTGAGATCTG
14qI-6_st CDBox: 14q(I-6) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-6) chr14:100475646-100475719 (+) 74 TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA
14qI-6_x_st CDBox: 14q(I-6) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-6) chr14:100475646-100475719 (+) 74 TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA
14qI-7_st CDBox: 14q(I-7) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-7) chr14:100477216-100477291 (+) 76 TGGATCAATGATGAGTATGCGTGGGGCATCTGAATCAAATATTCTGATTATACCCTGTCTGTATCTCTGAGGTCCA
14qI-8_st CDBox: 14q(I-8) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-8) chr14:100479541-100479613 (+) 73 TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA
14qI-8_x_st CDBox: 14q(I-8) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-8) chr14:100479541-100479613 (+) 73 TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA
14qI-9_x_st CDBox: 14q(I-9) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(I-9) chr14:100481739-100481809 (+) 71 TGGATCAATGATGAGTACCCTGGGGTGTCTGAATCTTGGATTTTGATTAAACCCTATAACTCTGAGGTCCA
14qII-10_st CDBox: 14q(II-10) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(II-10) chr14:100503142-100503212 (+) 71 AAGATCAATGATGACTACTGTTAGTGTATGAGTTACACATGATGAATACATGTCTGAAACTCTGAGGTCCA
14qII-11_st CDBox: 14q(II-11) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(II-11) chr14:100504201-100504274 (+) 74 TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA
14qII-11_x_st CDBox: 14q(II-11) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(II-11) chr14:100504201-100504274 (+) 74 TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA
14qII-12_st CDBox: 14q(II-12) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(II-12) chr14:100505038-100505111 (+) 74 TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA
14qII-12_x_st CDBox: 14q(II-12) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(II-12) chr14:100505038-100505111 (+) 74 TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA
14qII-13_st CDBox: 14q(II-13) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(II-13) chr14:100505969-100506041 (+) 73 TGGACCAGTGATGACCACTGGTGGCATATGAGTCATACACATGAACACCATGTTTCTAGAACTCTGAGGTCCA
14qII-14_st CDBox: 14q(II-14) Homo sapiens Oct 21, 2008 CDBox Affymetrix Proprietary Database 14q(II-14) chr14:100508193-100508266 (+) 74 TGGACCAATGATGACAACTGCCGGCGTATGAGTGTTGGGTGATGAATAATACGTGTCTAGAACTCTGAGGTCCA

Total number of rows: 7815

Table truncated, full table size 1326 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap