NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL887 Query DataSets for GPL887
Status Public on Jan 02, 2004
Title Agilent-012097 Human 1A Microarray (V2) G4110B (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4110B
 
Description
Agilent's Human 1A Oligo Microarray (V2) includes over 20K 60-mer oligonucleotide probes, sourced from the Incyte Foundation Database, RefSeq, and GenBank, and are designed to span conserved exons across the transcripts of the targeted full length genes. Coupled with Agilent's probe selection and validation processes, this design method gives the customer maximum confidence in data quality and prevents redundancy in gene coverage.

Arrays of this design have barcodes that begin with 16012097 or 2512097.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL7264.
 
Submission date Jan 02, 2004
Last update date Dec 06, 2012
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (2170) GSM21742, GSM21743, GSM21744, GSM21745, GSM21746, GSM21747 
Series (97)
GSE1322 laughter regulates postprandial blood glucose levels and gene expression
GSE1706 High Reproducibility Using Sodium Hydroxide Stripped Long Oligonucleotide DNA Microarrays
GSE1992 A New Breast Tumor Intrinsic Gene List Identifies Novel Characteristics that are Conserved Across Microarray Platforms
Relations
Alternative to GPL7264

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 105 215 BrightCorner BrightCorner pos
2 105 214 NegativeControl NegativeControl neg
3 105 213 NM_021996 A_23_P146576 FALSE NM_021996 NM_021996 26301 GBGT1 globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 Hs.495419 ENST00000372043 THC2423269 ref|NM_021996|gb|CR622726|gb|AK074639|ens|ENST00000372043 chr9:133058749-133058690 hs|9q34.2 Homo sapiens globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), mRNA [NM_021996] GO:0005975(carbohydrate metabolism)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016758(transferase activity, transferring hexosyl groups)|GO:0030145(manganese ion binding)|GO:0046872(metal ion binding) GGTATATGAGTTTACTAGGGGCTGCCACATGGCCATCCTGGCGGACAAGGCCAATGGCAT
4 105 212 A_23_P125016 A_23_P125016 FALSE CAAGCACAAGAGGAAGAAGGTCAAGCTAGCTGTCCTGAAATACTACAAGGTTGACGAGAA
5 105 211 NM_213622 A_23_P28555 FALSE NM_213622 NM_213622 10617 STAMBP STAM binding protein Hs.469018 THC2234524 ref|NM_213622|ref|NM_006463|ref|NM_201647|gb|CR598843 chr2:74001415-74001474 hs|2p13.1 Homo sapiens STAM binding protein (STAMBP), transcript variant 3, mRNA [NM_213622] GO:0004221(ubiquitin thiolesterase activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0006512(ubiquitin cycle)|GO:0007259(JAK-STAT cascade)|GO:0008237(metallopeptidase activity)|GO:0008270(zinc ion binding)|GO:0008284(positive regulation of cell proliferation)|GO:0016020(membrane)|GO:0046872(metal ion binding) TGTTTATATTTACCTCTGGGCTCAATAAGGGCATCTGTGCAGAAATTTGGAAGCCATTTA
6 105 210 E1A_r60_n9 E1A_r60_n9 pos
7 105 209 Pro25G Pro25G pos
8 105 208 NM_006256 A_23_P23227 FALSE NM_006256 NM_006256 5586 PKN2 protein kinase N2 Hs.440833 ENST00000370521 THC2247360 ref|NM_006256|gb|BC062620|ens|ENST00000370521|ens|ENST00000361145 chr1:89011189-89011248 hs|1p22.2 Homo sapiens protein kinase N2 (PKN2), mRNA [NM_006256] GO:0000166(nucleotide binding)|GO:0004674(protein serine/threonine kinase activity)|GO:0005524(ATP binding)|GO:0005622(intracellular)|GO:0006468(protein amino acid phosphorylation)|GO:0007165(signal transduction)|GO:0016740(transferase activity) AAGACCTCTTAAAAATAGCAACCCTTCATTTGCTCTCTGTGCCACCAATAGCTTCTGAGT
9 105 207 NM_152493 A_23_P137543 FALSE NM_152493 NM_152493 149076 FLJ25476 FLJ25476 protein Hs.524248 ENST00000373428 THC2258236 ref|NM_152493|ens|ENST00000373428|ens|ENST00000291413|gb|BC071632 chr1:33435078-33435137 hs|1p35.1 Homo sapiens FLJ25476 protein (FLJ25476), mRNA [NM_152493] GO:0003676(nucleic acid binding)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0008270(zinc ion binding)|GO:0046872(metal ion binding) ACTCCCTGTAAATACGCTGTTATACATACTGTTAACACCCCTTTGCTTTTTCTATGGGAC
10 105 206 NM_170741 A_23_P501193 FALSE NM_170741 NM_170741 3773 KCNJ16 potassium inwardly-rectifying channel, subfamily J, member 16 Hs.463985 ENST00000283936 THC2236782 ref|NM_170741|ref|NM_170742|ref|NM_018658|ens|ENST00000283936 chr17:65643118-65643177 hs|17q24.3 Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 16 (KCNJ16), transcript variant 2, mRNA [NM_170741] GO:0005242(inward rectifier potassium channel activity)|GO:0005244(voltage-gated ion channel activity)|GO:0005267(potassium channel activity)|GO:0006811(ion transport)|GO:0006813(potassium ion transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0030955(potassium ion binding) TACCGCTGATGTTTGCCTTGTCAATATCAGAATAGGGGCATCAGTGTCCCGTGAAATACA
11 105 205 NM_005121 A_23_P27247 FALSE NM_005121 NM_005121 9969 THRAP1 thyroid hormone receptor associated protein 1 Hs.282678 ENST00000262436 THC2236895 ref|NM_005121|ens|ENST00000262436|gb|AF117754|gb|AB011165 chr17:57383086-57383027 hs|17q23.2 Homo sapiens thyroid hormone receptor associated protein 1 (THRAP1), mRNA [NM_005121] GO:0000119(mediator complex)|GO:0004872(receptor activity)|GO:0005634(nucleus)|GO:0006350(transcription)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006367(transcription initiation from RNA polymerase II promoter)|GO:0016455(RNA polymerase II transcription mediator activity)|GO:0030374(ligand-dependent nuclear receptor transcription coactivator activity)|GO:0030521(androgen receptor signaling pathway)|GO:0042809(vitamin D receptor binding)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046966(thyroid hormone receptor binding) TTCTTCAGCAACCATTGGCCCTTGGTTACTTTGTATCAACTGCCAAAGCAGGTCCATTAC
12 105 204 NM_145260 A_23_P323270 FALSE NM_145260 NM_145260 130497 OSR1 odd-skipped related 1 (Drosophila) Hs.123933 ENST00000381236 THC2237979 ref|NM_145260|ens|ENST00000381236|ens|ENST00000272223|gb|CR602655 chr2:19473003-19472944 hs|2p24.1 Homo sapiens odd-skipped related 1 (Drosophila) (OSR1), mRNA [NM_145260] GO:0003676(nucleic acid binding)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0008270(zinc ion binding)|GO:0046872(metal ion binding) GAGGGAGCAGCCAGCCAAGAGCCGGGCGTTATATTGCGATTGGCACTTTATGCTGACCAT
13 105 203 NM_017419 A_23_P258433 FALSE NM_017419 NM_017419 51802 ACCN5 amiloride-sensitive cation channel 5, intestinal Hs.381349 ENST00000264432 NP852946 ref|NM_017419|ens|ENST00000264432|gb|AJ252011|thc|NP852946 chr4:157108800-157108741 hs|4q32.1 Homo sapiens amiloride-sensitive cation channel 5, intestinal (ACCN5), mRNA [NM_017419] ATCTTGGTGGTCAGCTGGGTCTATTTTGTGGGGCCAGTCTGATCACGATCATAGAAATTA
14 105 202 Pro25G Pro25G pos
15 105 201 NM_016085 A_23_P28649 FALSE NM_016085 NM_016085 51374 C2orf28 chromosome 2 open reading frame 28 Hs.9527 ENST00000380171 THC2399733 ref|NM_016085|ref|NM_080592|gb|BC035850|ens|ENST00000380171 chr2:27351064-27351123 hs|2p23.3 Homo sapiens chromosome 2 open reading frame 28 (C2orf28), transcript variant 1, mRNA [NM_016085] GO:0005554(molecular function unknown)|GO:0008372(cellular component unknown)|GO:0016020(membrane)|GO:0016021(integral to membrane) TTGTGTACCTGATGGTCCAGGTCTTTTGCAGTGTGTTTGTGCTGATGGTTTCCATGGATA
16 105 200 A_23_P96529 A_23_P96529 FALSE chrX:108422156-108422097 hs|Xq22.3 ATAGATGTGAACCTTATGGAAGAGTAGAGAGCCACCTCCAAGTTTAGTCATTCCAAAGTA
17 105 199 XM_084868 A_23_P2322 FALSE XM_084868 XM_084868 144448 TSPAN19 tetraspanin 19 Hs.156962 THC2304129 ref|XM_084868|ref|XM_940476|thc|THC2304129|thc|THC2303899 chr12:83913732-83912189 hs|12q21.31 PREDICTED: Homo sapiens tetraspanin 19 (TSPAN19), mRNA [XM_084868] GO:0016021(integral to membrane) GATGAGCCACTGAATGCAACTTACCTTGAGGGTTGTGAAAATAAAATCAGTGCATGGTAT
18 105 198 NM_005060 A_23_P372910 FALSE NM_005060 NM_005060 6097 RORC RAR-related orphan receptor C Hs.256022 ENST00000318247 NP1139689 ref|NM_005060|ref|NM_001001523|ens|ENST00000318247|ens|ENST00000318208 chr1:148598791-148598551 hs|1q21.3 Homo sapiens RAR-related orphan receptor C (RORC), transcript variant 1, mRNA [NM_005060] GO:0003700(transcription factor activity)|GO:0003707(steroid hormone receptor activity)|GO:0005634(nucleus)|GO:0006350(transcription)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0008270(zinc ion binding)|GO:0043565(sequence-specific DNA binding)|GO:0046872(metal ion binding) TTGGGCTGCAGCGAGCTCATCAGCTCCATCTTTGACTTCTCCCACTCCCTAAGTGCCTTG
19 105 197 NA NA ignore
20 105 196 NM_144674 A_23_P343357 FALSE NM_144674 NM_144674 146279 FLJ32871 hypothetical protein FLJ32871 Hs.143519 ENST00000283025 THC2413907 ref|NM_144674|ens|ENST00000283025|gb|AK057433|thc|THC2413907 chr16:10690642-10683467 hs|16p13.13 Homo sapiens hypothetical protein FLJ32871 (FLJ32871), mRNA [NM_144674] GO:0000226(microtubule cytoskeleton organization and biogenesis)|GO:0005874(microtubule) AAATTAGCTCAAAGAATTGATATCCAGATGCGGGATAACCGGGATGCTCAGCACGTGCTG

Total number of rows: 22575

Table truncated, full table size 11219 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL887_old_annotations.txt.gz 3.3 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap