|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jan 26, 2022 |
Title |
Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver |
Organism |
Mus musculus |
Experiment type |
Expression profiling by high throughput sequencing
|
Summary |
The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.
|
|
|
Overall design |
Examination of gene expressive levels in wildtype and foxo1 synonymous mutated mouse liver
|
|
|
Contributor(s) |
Peng S, Xiao W, Sun B, Huang N, Yang Y |
Citation missing |
Has this study been published? Please login to update or notify GEO. |
Submission date |
Jan 28, 2019 |
Last update date |
Jan 28, 2022 |
Contact name |
Bao-Fa Sun |
E-mail(s) |
sunbf@big.ac.cn
|
Organization name |
Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)
|
Street address |
Da-Tun Road
|
City |
Beijing |
ZIP/Postal code |
100101 |
Country |
China |
|
|
Platforms (1) |
GPL21493 |
Illumina HiSeq 3000 (Mus musculus) |
|
Samples (4)
|
|
Relations |
BioProject |
PRJNA517499 |
SRA |
SRP182721 |
Supplementary file |
Size |
Download |
File type/resource |
GSE125786_RAW.tar |
580.0 Kb |
(http)(custom) |
TAR (of TXT) |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|