 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 10, 2020 |
| Title |
Cyclin D3 drives inertial cell cycling in dark zone germinal center B cells |
| Organism |
Mus musculus |
| Experiment type |
Expression profiling by high throughput sequencing
|
| Summary |
Germinal centers (GCs) are the sites of affinity maturation, the process by which antibodies improve their affinity for antigen over time (Cyster and Allen, 2019; De Silva and Klein, 2015; Eisen, 2014; Mesin et al., 2016; Rajewsky, 1996; Shlomchik et al., 2019; Victora and Nussenzweig, 2012). For efficient affinity maturation, GC B cells must cycle between two major transcriptional states, associated with localization of B cells to each of the two microanatomical “zones” of the GC. When in the dark zone (DZ), B cells proliferate vigorously while they mutate their immunoglobulin genes by somatic hypermutation (SHM). After transition to the light zone (LZ), B cells bearing advantageous mutations are selectively driven to clonally expand, based at least in part on their ability to bind and present antigen to GC-resident T follicular helper (Tfh) cells (Victora et al., 2010). Successive cycles of somatic hypermutation and affinity-based selection ultimately enrich for higher-affinity cells in among the GC B cell population, in a process known as cyclic re-entry (MacLennan, 1994; Victora and Nussenzweig, 2012).
|
| |
|
| Overall design |
SmartSeq2: Libraries were prepared as previously described (Trombetta et al., 2014). Briefly, nucleic acids were extracted from sorted single cell using RNAClean XP SPRI beads (Beckman Coulter), and RNA was hybridized first using RT primer (/5BiosG/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN) then reverse-transcribed into cDNA using TSO primer (AAGCAGTGGTATCAACGCAGAGTACATrGrGrG) and RT maxima reverse transcriptase (Thermo Fisher Scientific). cDNA was amplified using ISPCR primer (AAGCAGTGGTATCAACGCAGAGT) and KAPA HiFi HotStart ReadyMix (Fisher Scientific), cleaned up using RNAClean XP SPRI beads three times, and tagmented using Nextera XT DNA Library Preparation Kit (Illumina). For each sequencing batch, up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally, dual-barcoded libraries were pooled and sequenced using Illumina Hiseq2500 (experiment 1)/Nextseq 550 (experiments 2-4) platform.
|
| |
|
| Contributor(s) |
Pae J, Ersching J, Castro TB, Schips M, Mesin L, Allon SJ, Ordovas-Montanes J, Mlynarczyk C, Melnick A, Efeyan A, Shalek AK, Meyer-Hermann M, Victora GD |
| Citation(s) |
33332554 |
| Submission date |
Nov 25, 2020 |
| Last update date |
Mar 11, 2021 |
| Contact name |
Gabriel Victora |
| E-mail(s) |
gvictora@rockefeller.edu
|
| Organization name |
The Rockefeller University
|
| Street address |
1230 York Avenue
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platforms (2) |
|
| Samples (1814)
|
|
| Relations |
| BioProject |
PRJNA680802 |
| SRA |
SRP294192 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSE162182_1dec_07082018-scRNAseq.txt.gz |
3.7 Mb |
(ftp)(http) |
TXT |
| GSE162182_2dec_04092017-scRNAseq.txt.gz |
4.0 Mb |
(ftp)(http) |
TXT |
| GSE162182_3dec_04192019-scRNAseq.txt.gz |
3.5 Mb |
(ftp)(http) |
TXT |
| GSE162182_4dec_09022020-scRNAseq.txt.gz |
3.6 Mb |
(ftp)(http) |
TXT |
| GSE162182_5dec_31072020-scRNAseq.txt.gz |
3.1 Mb |
(ftp)(http) |
TXT |
| GSE162182_Dec.metadata.tsv.gz |
98.9 Kb |
(ftp)(http) |
TSV |
| GSE162182_Dec.norm.counts.tsv.gz |
11.8 Mb |
(ftp)(http) |
TSV |
| GSE162182_Dec.pca.tsv.gz |
504.5 Kb |
(ftp)(http) |
TSV |
| GSE162182_Dec.raw.counts.tsv.gz |
7.8 Mb |
(ftp)(http) |
TSV |
| GSE162182_Dec.umap.tsv.gz |
25.2 Kb |
(ftp)(http) |
TSV |
| GSE162182_d3.metadata.tsv.gz |
28.1 Kb |
(ftp)(http) |
TSV |
| GSE162182_d3.norm.counts.tsv.gz |
3.1 Mb |
(ftp)(http) |
TSV |
| GSE162182_d3.pca.tsv.gz |
155.3 Kb |
(ftp)(http) |
TSV |
| GSE162182_d3.raw.counts.tsv.gz |
2.1 Mb |
(ftp)(http) |
TSV |
| GSE162182_d3.umap.tsv.gz |
7.9 Kb |
(ftp)(http) |
TSV |
SRA Run Selector |
| Processed data are available on Series record |
| Raw data are available in SRA |
|
|
|
|
 |
Less...
More...