|
| Status |
Public on Dec 23, 2021 |
| Title |
The evolution, evolvability, and engineering of gene regulatory DNA [GPRA] |
| Organism |
Saccharomyces cerevisiae |
| Experiment type |
Other
|
| Summary |
In order to generate data produce a generalizable sequence-to-expression model, we randomly sampled ~21 million 80 bp sequences and tested their activity as promoters (in yeast) by measuring expression level by FACS (sorting into 18 bins).
|
| |
|
| Overall design |
Here, all libraries tested have the following sequences flanking the random 80 bp oligo: the pTpA distal region was (pT) GCTAGCAGGAATGATGCAAAAGGTTCCCGATTCGAACTGCATTTTTTTCACATC and proximal region (pA) was GGTTACGGCTGTTTCTTAATTAAAAAAAGATAGAAAACATTAGGAGTGTAACACAAGACTTTCGGATCCTGAGCAGGCAAGATAAACGA (up to the theoretical TSS). 80 Ns were inserted in between proximal and distal regions. Here, both experiments represent yeast grown in SD-Ura (Sunrise Sciences), and the designed-sequence library used a strain of S288C with Ura3 deleted, while the large-scale random promoter library used strain Y8205 (Boone Lab).
|
| |
|
| Contributor(s) |
de Boer CG, Vaishnav E |
| Citation(s) |
35264797 |
| NIH grant(s) |
| Grant ID |
Grant title |
Affiliation |
Name |
| K99 HG009920 |
Learning the rules of enhancer activity to understand non-coding genetic variation in autoimmune disease |
THE BROAD INSTITUTE, INC. |
Carl de Boer |
|
| Submission date |
Dec 11, 2020 |
| Last update date |
Mar 18, 2022 |
| Contact name |
Carl G de Boer |
| Organization name |
The Broad Institute
|
| Lab |
Aviv Regev
|
| Street address |
415 Main St
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02139 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL19756 |
Illumina NextSeq 500 (Saccharomyces cerevisiae) |
|
| Samples (36)
|
|
| Relations |
| BioProject |
PRJNA684558 |
| SRA |
SRP297661 |
Less...
More...