NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Series GSE16798 Query DataSets for GSE16798
Status Public on Dec 10, 2009
Title Genes regulated after knock-down of Pirin in U937 cells
Organism Homo sapiens
Experiment type Expression profiling by array
Summary Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation.

Keywords: Transcriptional regulation, knock-down using shRNA
 
Overall design We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control.

shPIR#7 oligonucleotide sequences:
Human PIR#7-for:
TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC
Human PIR#7-rev:
TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA

For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
 
Contributor(s) Alcalay M
Citation(s) 20010624
Submission date Jun 24, 2009
Last update date Mar 25, 2019
Contact name Myriam Alcalay
E-mail(s) myriam.alcalay@ieo.eu
Organization name European Institute of Oncology
Department Experimental Oncology
Lab Functional Genomics
Street address Via Adamello 16
City Milan
ZIP/Postal code 20139
Country Italy
 
Platforms (1)
GPL570 [HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array
Samples (4)
GSM421933 U937 cells with knock-down of Pirin - Replica 1
GSM421934 U937 cells with knock-down of Pirin - Replica 2
GSM421935 U937 cells infected with empty pSICO-R vector - Replica 1
Relations
BioProject PRJNA117507

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp
Series Matrix File(s) TXTHelp

Supplementary file Size Download File type/resource
GSE16798_RAW.tar 19.8 Mb (http)(custom) TAR (of CEL)
Raw data provided as supplementary file
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap