|
| Status |
Public on Jan 01, 2022 |
| Title |
Gene expression profiles from the cardiac tissue of HIPK2-knockout and Wild Type (WT) mice |
| Organism |
Mus musculus |
| Experiment type |
Expression profiling by array
|
| Summary |
We use Affymetrix Gene Chip Array to screen the targets of HIPK2 in heart. Total RNA was extracted from 8-week-old HIPK2-knockout and Wild Type (WT) mice.
|
| |
|
| Overall design |
C57BL/6 HIPK2-/- mice were generated in Beijing Viewsolid Bioteh Co. Ltd (Beijing, China) by embryo injection of CRISPRs targeting the second exon (guide RNA sequences: AAGTTCCAACTGGGACATGACTGGGT) of the mouse Hipk2 gene. Frameshift mutations (56bp deletion: TGGGTACGGCTCCCACAGCAAAGTGTACAGCCAGAGCAAGAACATACCACCTTCTC) were identified and crossed with C57BL/6 WT mice for colony expansion and subsequent experiments. Tail biopsies of HIPK2-/- mice were analyzed by genomic PCR (forward primer 5’- TTCAGAGTGGAAGAACAATC -3’ and reverse primer 5’- TTGGTAGGTGTCAAGGAG -3’).
|
| |
|
| Contributor(s) |
Zhou Q, Xiao J |
| Citation(s) |
36182775 |
| Submission date |
Mar 23, 2021 |
| Last update date |
Oct 06, 2022 |
| Contact name |
Qiulian Zhou |
| E-mail(s) |
qlzhou1992@i.shu.edu.cn
|
| Organization name |
Shanghai University
|
| Department |
Institute of Cardiovascular Sciences
|
| Lab |
Cardiac Regeneration and Ageing Lab
|
| Street address |
Nanchen Road
|
| City |
Shanghai |
| ZIP/Postal code |
200444 |
| Country |
China |
| |
|
| Platforms (1) |
| GPL21163 |
Agilent-074809 SurePrint G3 Mouse GE v2 8x60K Microarray [Probe Name version] |
|
| Samples (10)
|
|
| Relations |
| BioProject |
PRJNA716600 |
Less...
More...