GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Series GSE46329 Query DataSets for GSE46329
Status Public on May 10, 2013
Title Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells
Organism Homo sapiens
Experiment type Expression profiling by array
Summary Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Overall design LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
Contributor(s) Chen Y, Sawyers CL
Citation(s) 23817021
Submission date Apr 23, 2013
Last update date Aug 16, 2018
Contact name Yu Chen
Phone 646-888-3356
Organization name Memorial Sloan Kettering Cancer Center
Department Human Oncology and Pathogenesis Program
Lab Chen
Street address 1275 York Ave, Box 20
City New York
State/province NY
ZIP/Postal code 10065
Country USA
Platforms (1)
GPL6947 Illumina HumanHT-12 V3.0 expression beadchip
Samples (9)
GSM1128665 shScr Replicate 1
GSM1128666 shScr Replicate 2
GSM1128667 shScr Replicate 3
This SubSeries is part of SuperSeries:
GSE47220 ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss
BioProject PRJNA202375

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp
Series Matrix File(s) TXTHelp

Supplementary file Size Download File type/resource
GSE46329_RAW.tar 6.2 Mb (http)(custom) TAR
GSE46329_non-normalized.txt.gz 3.0 Mb (ftp)(http) TXT
Raw data are available on Series record
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap