|
| Status |
Public on Jan 15, 2014 |
| Title |
SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by array
|
| Summary |
Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
|
| |
|
| Overall design |
HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
|
| |
|
| Contributor(s) |
Stegmaier K |
| Citation(s) |
24525236 |
| Submission date |
Jan 14, 2014 |
| Last update date |
Jan 17, 2017 |
| Contact name |
Gabriela Alexe |
| E-mail(s) |
galexe@broadinstitute.org
|
| Organization name |
Broad Institute
|
| Department |
Computational Biology and Bioinformatics
|
| Street address |
415 Main St.
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL3921 |
[HT_HG-U133A] Affymetrix HT Human Genome U133A Array |
|
| Samples (21)
|
|
| Relations |
| BioProject |
PRJNA234508 |
Less...
More...