|
Status |
Public on Mar 24, 2006 |
Title |
100nM Scrambled oligo transfection replicate 1 |
Sample type |
RNA |
|
|
Source name |
E14TG2a mouse embroyonic stem cells (ATCC, CRL-1841)
|
Organism |
Mus musculus |
Characteristics |
mouse embryonic stem cell
|
Extracted molecule |
total RNA |
Extraction protocol |
Mouse embryonic stem cells were transfected with 100nM Scrambled (Ambion; AGACUAGCGGUAUCUUUAUCCC) oligomer using Lipofectamine 2000 (Invitorgen protocol) and total RNA extracted after 72h using TRIzol reagent (Invitrogen) and further purified by Rneasy column (Qiagen;#75144).
|
Label |
biotin
|
Label protocol |
First & Second strand cDNA synthesis, cRNA Biotin-labelling and cRNA purification were performed using the Illumina TotalPrepRNA Amplification kit (Ambion;#IL1791). 850ng labeled cRNA were mixed with Hyb Mix (Hyb E1+Formamide) as according to instructions in BeadStation 500X Gene Expression System (Illumina) and used for microarray (Illumina Mouse Refseq-8 Array) staining.
|
|
|
Hybridization protocol |
All Hybridisation and Wash procedures were performed following instructions in the Experienced User Card #2, Hybridize/Wash 8-sample BeadChip protocol (Illumina). Briefly, 34ul of the Hyb mix with labeled cRNA sample was dispensed onto the center of each array and allowed to hyb with rotations in a pre-heated oven for 16-20h at 55*C. Washes were done with Wash E1BC solution, Block E1 solution was used for blocking and detection performed by Block E1 solution+Streptavidin-Cy3/5.
|
Scan protocol |
standard Illumina procedures
|
Description |
100nM Scrambled oligo transfection replicate 1
|
Data processing |
RMA normalization
|
|
|
Submission date |
Mar 21, 2006 |
Last update date |
Mar 21, 2008 |
Contact name |
Bing Lim |
E-mail(s) |
limb1@gis.a-star.edu.sg
|
Phone |
+65 64788156
|
Fax |
+65 64789005
|
URL |
http://www.gis.a-star.edu.sg
|
Organization name |
Genome Institute of Singapore
|
Department |
Stem Cell and Developmental Biology
|
Lab |
Stem Cell and Developmental Biology
|
Street address |
60 Biopolis street, #02-01 Genome
|
City |
Singapore |
State/province |
Singapore |
ZIP/Postal code |
138672 |
Country |
Singapore |
|
|
Platform ID |
GPL4865 |
Series (1) |
GSE4522 |
MicroRNA-134 Modulates Mouse Embryonic Stem Cell Differentiation |
|